RchiOBHm_Chr7g0191241

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
10034592 .. 10034759
168 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17088

Sequence Viewer

Length: 168 bp
ATGGCCGTGAACGTCAAAGGATATTTCCACTGGGCTCTATTCGACGACTGGGAGTGGGTGGAAGGCTATACTCCAGGGTTCGGGCTTTACTATGTCGAACATAAAGACAATCTCAAGAGCATTCCTAAAGAATCTGCTAAGTGGCTTCCAATGTTCTTAAAGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.54

Weight (kDa)

6.02

Isoelectric Point (pI)

7.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 3 - 50 2e-13 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000392)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G25630 AT2G44450 AT2G44450 AT3G60130 AT3G60130 AT3G60130 AT5G42260 AT5G44640
fragaria_vesca FvH4_5g07160 FvH4_5g07180 FvH4_5g07811 FvH4_5g07831 FvH4_5g07831 FvH4_5g07832 FvH4_6g19950 FvH4_6g19950 FvH4_6g19950
malus_domestica MD01G1120900.v1.1 MD06G1144600.v1.1 MD06G1144800.v1.1 MD06G1145700.v1.1 MD06G1146100.v1.1 MD06G1147000.v1.1 MD08G1072600.v1.1 MD08G1142300.v1.1 MD08G1191100.v1.1 MD14G1159400.v1.1 MD14G1160300.v1.1 MD14G1160600.v1.1 MD14G1160700.v1.1 MD14G1161400.v1.1
prunus_persica Prupe.1G525400_v2.0.a1 Prupe.1G583900_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G156500_v2.0.a1
pyrus_communis pycom06g13390 pycom06g13520 pycom06g13560 pycom06g13640 pycom08g12030 pycom14g13310 pycom14g13430
rosa_chinensis RchiOBHm_Chr3g0475401 RchiOBHm_Chr7g0190551 RchiOBHm_Chr7g0190631 RchiOBHm_Chr7g0190641 RchiOBHm_Chr7g0191241 RchiOBHm_Chr7g0191251 RchiOBHm_Chr7g0191261 RchiOBHm_Chr7g0202591
rosa_laevigata RLG00000004507 RLG00000004508 RLG00000004516 RLG00000023846 RLG00000035079
rosa_multiflora Rmu_co8005672.1_g000001 Rmu_co8018538.1_g000001 Rmu_sc0000526.1_g000002 Rmu_sc0001786.1_g000011 Rmu_sc0006709.1_g000007 Rmu_sc0006709.1_g000008 Rmu_sc0016637.1_g000004
rosa_roxburghii Rroxscaffold_1G00018560 Rroxscaffold_1G00024050 Rroxscaffold_3G00264440 Rroxscaffold_3G00264450 Rroxscaffold_4G00306640 Rroxscaffold_6G00406340
rosa_rugosa Rorug03G0295600 Rorug05G0298500 Rorug06G0072900 Rorug06G0505100 Rorug06G0505800 Rorug06G0505900 Rorug06G0506000
rosa_samantha Rh1CG344200 Rh2AG107900 Rh3AG198700 Rh3CG223000 Rh5AG369500 Rh5BG469700 Rh5BG469800 Rh5DG483000 Rh7AG111700 Rh7AG112400 Rh7AG112500 Rh7AG112600 Rh7CG116400 Rh7CG117400 Rh7CG117500 Rh7CG117600 Rh7CG122100 Rh7CG122200 Rh7DG115600 Rh7DG116400 Rh7DG116500
rosa_wichuraiana Rw3G018030 Rw7G009740 Rw7G009810 Rw7G009820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 80
AjnI CCWGG 1 cut(s) 73
AoxI GGCC 1 cut(s) 3
BanII GRGCYC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 75
BmrI ACTGGG 2 cut(s) 40, 58
BmuI ACTGGG 2 cut(s) 40, 58
BpmI CTGGAG 1 cut(s) 57
BpuEI CTTGAG 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 80
Bse1I ACTGG 2 cut(s) 35, 53
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 80
BseNI ACTGG 2 cut(s) 35, 53
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 80
BsmI GAATGC 1 cut(s) 120
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 37
BspANI GGCC 1 cut(s) 5
BsrI ACTGG 2 cut(s) 35, 53
BssECI CCNNGG 1 cut(s) 74
Bst2UI CCWGG 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 138
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 28
CviJI RGCY 5 cut(s) 5, 35, 66, 85, 145
CviKI_1 RGCY 5 cut(s) 5, 35, 66, 85, 145
DdeI CTNAG 1 cut(s) 138
EaeI YGGCCR 1 cut(s) 3
Eco24I GRGCYC 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 73
EcoT38I GRGCYC 1 cut(s) 37
FaiI YATR 3 cut(s) 69, 93, 102
FriOI GRGCYC 1 cut(s) 37
GsuI CTGGAG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 115
Hpy8I GTNNAC 1 cut(s) 10
Hpy99I CGWCG 1 cut(s) 47
HpyAV CCTTC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 138
HpySE526I ACGT 1 cut(s) 12
LpnPI CCDG 4 cut(s) 16, 34, 60, 87
MaeII ACGT 1 cut(s) 12
MhlI GDGCHC 1 cut(s) 37
MseI TTAA 1 cut(s) 158
MspR9I CCNGG 1 cut(s) 75
Mva1269I GAATGC 1 cut(s) 120
MvaI CCWGG 1 cut(s) 75
PctI GAATGC 1 cut(s) 120
PfeI GAWTC 1 cut(s) 131
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 37
SetI ASST 1 cut(s) 15
SgeI CNNG 7 cut(s) 19, 43, 61, 86, 87, 94, 127
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
StyD4I CCNGG 1 cut(s) 73
TaiI ACGT 1 cut(s) 15
TaqI TCGA 2 cut(s) 42, 96
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
TscAI CASTG 1 cut(s) 35
TspRI CASTG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.