Rroxscaffold_1G00018560

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000392
Physical Location & Seq
Reverse (-)
22744608 .. 22744997
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00018560.1

Sequence Viewer

Length: 348 bp
ATGGAATCCCTATATATTGGTCCTAAGGCTGAAGGAATGAATTACATCTACACTTATCCCAAAGGTCGACTGCAAAATCTATTGGAGTTCATGAGGCAAAAATACAGAAGTTCTAAAATCTACAATACTGAAAATGGAATTTCTGGGGCAAAGAACGATAAACGTGGGCTTGACAAACCACTAAAGGATCCTTGTAGAGTTGAAAGGATTCTTCGGCATTTGTACAGGCTTAACATGGCAATAAAGAATGGTGCGAATTGGTTGGATAGCTATATTCCAATATTTGGGCTTTACTACATCGATTACAAAGACGATCTCAAGCGCATTCCTAAAGAATCTGCTCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110
Pfam Domains
Protein Families
Glyco_hydro_1

Protein Analysis

115

Amino Acids

13.59

Weight (kDa)

9.57

Isoelectric Point (pI)

23.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 13 - 114 3.1e-10 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000392)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G25630 AT2G44450 AT2G44450 AT3G60130 AT3G60130 AT3G60130 AT5G42260 AT5G44640
fragaria_vesca FvH4_5g07160 FvH4_5g07180 FvH4_5g07811 FvH4_5g07831 FvH4_5g07831 FvH4_5g07832 FvH4_6g19950 FvH4_6g19950 FvH4_6g19950
malus_domestica MD01G1120900.v1.1 MD06G1144600.v1.1 MD06G1144800.v1.1 MD06G1145700.v1.1 MD06G1146100.v1.1 MD06G1147000.v1.1 MD08G1072600.v1.1 MD08G1142300.v1.1 MD08G1191100.v1.1 MD14G1159400.v1.1 MD14G1160300.v1.1 MD14G1160600.v1.1 MD14G1160700.v1.1 MD14G1161400.v1.1
prunus_persica Prupe.1G525400_v2.0.a1 Prupe.1G583900_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G156500_v2.0.a1
pyrus_communis pycom06g13390 pycom06g13520 pycom06g13560 pycom06g13640 pycom08g12030 pycom14g13310 pycom14g13430
rosa_chinensis RchiOBHm_Chr3g0475401 RchiOBHm_Chr7g0190551 RchiOBHm_Chr7g0190631 RchiOBHm_Chr7g0190641 RchiOBHm_Chr7g0191241 RchiOBHm_Chr7g0191251 RchiOBHm_Chr7g0191261 RchiOBHm_Chr7g0202591
rosa_laevigata RLG00000004507 RLG00000004508 RLG00000004516 RLG00000023846 RLG00000035079
rosa_multiflora Rmu_co8005672.1_g000001 Rmu_co8018538.1_g000001 Rmu_sc0000526.1_g000002 Rmu_sc0001786.1_g000011 Rmu_sc0006709.1_g000007 Rmu_sc0006709.1_g000008 Rmu_sc0016637.1_g000004
rosa_roxburghii Rroxscaffold_1G00018560 Rroxscaffold_1G00024050 Rroxscaffold_3G00264440 Rroxscaffold_3G00264450 Rroxscaffold_4G00306640 Rroxscaffold_6G00406340
rosa_rugosa Rorug03G0295600 Rorug05G0298500 Rorug06G0072900 Rorug06G0505100 Rorug06G0505800 Rorug06G0505900 Rorug06G0506000
rosa_samantha Rh1CG344200 Rh2AG107900 Rh3AG198700 Rh3CG223000 Rh5AG369500 Rh5BG469700 Rh5BG469800 Rh5DG483000 Rh7AG111700 Rh7AG112400 Rh7AG112500 Rh7AG112600 Rh7CG116400 Rh7CG117400 Rh7CG117500 Rh7CG117600 Rh7CG122100 Rh7CG122200 Rh7DG115600 Rh7DG116400 Rh7DG116500
rosa_wichuraiana Rw3G018030 Rw7G009740 Rw7G009810 Rw7G009820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 284
AccI GTMKAC 1 cut(s) 67
AclWI GGATC 2 cut(s) 182, 195
AcsI RAATTY 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 51
AfaI GTAC 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 284
AgsI TTSAA 1 cut(s) 203
AluBI AGCT 1 cut(s) 270
AluI AGCT 1 cut(s) 270
AlwI GGATC 2 cut(s) 182, 195
ApoI RAATTY 1 cut(s) 138
Asp700I GAANNNNTTC 1 cut(s) 207
AspLEI GCGC 1 cut(s) 324
AspS9I GGNCC 1 cut(s) 20
AvaII GGWCC 1 cut(s) 20
AxyI CCTNAGG 1 cut(s) 24
BamHI GGATCC 1 cut(s) 187
Bme18I GGWCC 1 cut(s) 20
BmgT120I GGNCC 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 302
Bsa29I ATCGAT 1 cut(s) 300
Bsc4I CCNNNNNNNGG 1 cut(s) 284
Bse21I CCTNAGG 1 cut(s) 24
BseCI ATCGAT 1 cut(s) 300
BseLI CCNNNNNNNGG 1 cut(s) 284
BshVI ATCGAT 1 cut(s) 300
BslI CCNNNNNNNGG 1 cut(s) 284
BsmI GAATGC 1 cut(s) 324
Bsp1407I TGTACA 1 cut(s) 222
Bsp143I GATC 2 cut(s) 187, 313
BspDI ATCGAT 1 cut(s) 300
BspHI TCATGA 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 2 cut(s) 182, 195
BsrGI TGTACA 1 cut(s) 222
BssMI GATC 2 cut(s) 187, 313
BstAUI TGTACA 1 cut(s) 222
BstDEI CTNAG 2 cut(s) 24, 342
BstHHI GCGC 1 cut(s) 324
BstKTI GATC 2 cut(s) 190, 316
BstMBI GATC 2 cut(s) 187, 313
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
Bsu15I ATCGAT 1 cut(s) 300
Bsu36I CCTNAGG 1 cut(s) 24
BsuTUI ATCGAT 1 cut(s) 300
CciI TCATGA 1 cut(s) 90
CfoI GCGC 1 cut(s) 324
Cfr13I GGNCC 1 cut(s) 20
ClaI ATCGAT 1 cut(s) 300
Csp6I GTAC 1 cut(s) 223
CviAII CATG 2 cut(s) 91, 235
CviJI RGCY 5 cut(s) 29, 169, 229, 270, 289
CviKI_1 RGCY 5 cut(s) 29, 169, 229, 270, 289
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 2 cut(s) 24, 342
DpnI GATC 2 cut(s) 189, 315
DpnII GATC 2 cut(s) 187, 313
Eco47I GGWCC 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 51
Eco81I CCTNAGG 1 cut(s) 24
FaeI CATG 2 cut(s) 94, 238
FaiI YATR 5 cut(s) 13, 15, 92, 236, 273
FatI CATG 2 cut(s) 90, 234
FblI GTMKAC 1 cut(s) 67
GlaI GCGC 1 cut(s) 323
HhaI GCGC 1 cut(s) 324
Hin1II CATG 2 cut(s) 94, 238
Hin6I GCGC 1 cut(s) 322
HinP1I GCGC 1 cut(s) 322
HincII GTYRAC 1 cut(s) 68
HindII GTYRAC 1 cut(s) 68
HinfI GANTC 3 cut(s) 5, 208, 335
Hpy166II GTNNAC 1 cut(s) 68
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 73
HpyF3I CTNAG 2 cut(s) 24, 342
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 2 cut(s) 94, 238
HspAI GCGC 1 cut(s) 322
Kzo9I GATC 2 cut(s) 187, 313
LpnPI CCDG 2 cut(s) 129, 211
MaeII ACGT 1 cut(s) 163
MalI GATC 2 cut(s) 189, 315
MboI GATC 2 cut(s) 187, 313
MboII GAAGA 1 cut(s) 203
MflI RGATCY 1 cut(s) 187
MluCI AATT 3 cut(s) 40, 138, 256
MmeI TCCRAC 1 cut(s) 243
MnlI CCTC 1 cut(s) 87
MroXI GAANNNNTTC 1 cut(s) 207
MseI TTAA 1 cut(s) 231
Mva1269I GAATGC 1 cut(s) 324
NdeII GATC 2 cut(s) 187, 313
NlaIII CATG 2 cut(s) 94, 238
NlaIV GGNNCC 1 cut(s) 189
PagI TCATGA 1 cut(s) 90
PctI GAATGC 1 cut(s) 324
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 3 cut(s) 5, 208, 335
PflMI CCANNNNNTGG 1 cut(s) 284
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 20
PsuI RGATCY 1 cut(s) 187
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SalI GTCGAC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 231
Sau3AI GATC 2 cut(s) 187, 313
Sau96I GGNCC 1 cut(s) 20
SetI ASST 3 cut(s) 67, 166, 272
SgeI CNNG 8 cut(s) 103, 156, 176, 182, 204, 238, 247, 331
SinI GGWCC 1 cut(s) 20
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
Sse9I AATT 3 cut(s) 40, 138, 256
SspI AATATT 1 cut(s) 282
TaiI ACGT 1 cut(s) 166
TaqI TCGA 2 cut(s) 67, 300
TasI AATT 3 cut(s) 40, 138, 256
TatI WGTACW 1 cut(s) 222
TfiI GAWTC 3 cut(s) 5, 208, 335
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 53, 79
Van91I CCANNNNNTGG 1 cut(s) 284
VpaK11BI GGWCC 1 cut(s) 20
XapI RAATTY 1 cut(s) 138
XmiI GTMKAC 1 cut(s) 67
XmnI GAANNNNTTC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.