RchiOBHm_Chr1g0314531

NEDD8 ultimate buster

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
1819494 .. 1821150
1657 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54514

Sequence Viewer

Length: 174 bp
ATGGGATCGGAGACTGATCAGCGGTGTGATTTAATCAGGGTTCAAGAAATCATGATGAGCCTGATGTTACATACCAATGCAAAGCAACTGATTAAAGCACAAAATTACAAAGATGCAATGGAAGTGCTCAGCATGGAGGAGGAGGCTTTTTCTCTGCGATCCATCGGTTATTAA

Protein Analysis

57

Amino Acids

6.6

Weight (kDa)

4.87

Isoelectric Point (pI)

50.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000694)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 22
AclWI GGATC 2 cut(s) 13, 153
AgsI TTSAA 1 cut(s) 44
Alw21I GWGCWC 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 5
AlwI GGATC 2 cut(s) 13, 153
Bbv12I GWGCWC 1 cut(s) 129
BccI CCATC 1 cut(s) 170
BclI TGATCA 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 5
BlpI GCTNAGC 1 cut(s) 128
BmsI GCATC 1 cut(s) 103
Bpu1102I GCTNAGC 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 142
BseRI GAGGAG 2 cut(s) 152, 155
BsiHKAI GWGCWC 1 cut(s) 129
BsmAI GTCTC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 3 cut(s) 5, 16, 158
Bsp1720I GCTNAGC 1 cut(s) 128
BspACI CCGC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 141
BspHI TCATGA 1 cut(s) 51
BspPI GGATC 2 cut(s) 13, 153
BsrDI GCAATG 1 cut(s) 123
BssMI GATC 3 cut(s) 5, 16, 158
BstDEI CTNAG 1 cut(s) 128
BstKTI GATC 3 cut(s) 8, 19, 161
BstMAI GTCTC 1 cut(s) 5
BstMBI GATC 3 cut(s) 5, 16, 158
CciI TCATGA 1 cut(s) 51
CviAII CATG 2 cut(s) 52, 133
CviJI RGCY 2 cut(s) 60, 146
CviKI_1 RGCY 2 cut(s) 60, 146
DdeI CTNAG 1 cut(s) 128
DpnI GATC 3 cut(s) 7, 18, 160
DpnII GATC 3 cut(s) 5, 16, 158
FaeI CATG 2 cut(s) 55, 136
FaiI YATR 3 cut(s) 53, 72, 134
FatI CATG 2 cut(s) 51, 132
FbaI TGATCA 1 cut(s) 16
Hin1II CATG 2 cut(s) 55, 136
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 44, 52
HpyCH4V TGCA 2 cut(s) 80, 116
HpyF3I CTNAG 1 cut(s) 128
Hsp92II CATG 2 cut(s) 55, 136
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 3 cut(s) 5, 16, 158
LpnPI CCDG 2 cut(s) 22, 74
LweI GCATC 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 66
MalI GATC 3 cut(s) 7, 18, 160
MboI GATC 3 cut(s) 5, 16, 158
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 1 cut(s) 103
MnlI CCTC 3 cut(s) 130, 133, 136
MseI TTAA 3 cut(s) 32, 93, 172
MslI CAYNNNNRTG 1 cut(s) 75
MspA1I CMGCKG 1 cut(s) 22
NdeII GATC 3 cut(s) 5, 16, 158
NlaIII CATG 2 cut(s) 55, 136
PagI TCATGA 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 3 cut(s) 32, 93, 172
Sau3AI GATC 3 cut(s) 5, 16, 158
SduI GDGCHC 1 cut(s) 129
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 5 cut(s) 49, 56, 64, 73, 145
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 1 cut(s) 103
SsiI CCGC 1 cut(s) 22
TasI AATT 1 cut(s) 103
Tru1I TTAA 3 cut(s) 32, 93, 172
Tru9I TTAA 3 cut(s) 32, 93, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.