Rh4BG145100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
25888718 .. 25924702
35985 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG145100.1

Sequence Viewer

Length: 351 bp
ATGGCTGTTTGTGTCCCTCAGTCCATCGAGTCCCTCACTCTATTTCCCACTATAAATCAGACGCACATCCCCTACAATGGGGACTCCACCATTTCAATCAAGACCCCTTTCCCTCTGCTCTGGTGTCCTGTGAACCCAACTAAACGACACCCTCGCCATGTAGAGGCAGCTTCACCAAACAGTTCTCACATTCACAACCCAGATTCAGTTGTTGTGATTGAAAAAGGTTTTTCCTTTGATCAGTGTTATAGGTTGAGTATGTGTGTGTGTCTTTATTCCATTGCAGCTGTTGATCGTGTCATGGTAAGAGGGAGGCTTCCCTACACTACCAGGGCCAGGGCGAACCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.0

Weight (kDa)

8.97

Isoelectric Point (pI)

55.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000694)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 4 cut(s) 77, 78, 163, 336
AgsI TTSAA 2 cut(s) 96, 221
AjnI CCWGG 2 cut(s) 329, 335
AluBI AGCT 2 cut(s) 170, 287
AluI AGCT 2 cut(s) 170, 287
AoxI GGCC 1 cut(s) 333
ApeKI GCWGC 2 cut(s) 167, 284
AspS9I GGNCC 1 cut(s) 333
AsuHPI GGTGA 1 cut(s) 165
BbvI GCAGC 2 cut(s) 179, 296
BccI CCATC 1 cut(s) 32
BciT130I CCWGG 2 cut(s) 331, 337
BclI TGATCA 1 cut(s) 238
BisI GCNGC 2 cut(s) 168, 285
BlsI GCNGC 2 cut(s) 169, 286
Bme1390I CCNGG 2 cut(s) 331, 337
BmgT120I GGNCC 1 cut(s) 333
BmrFI CCNGG 2 cut(s) 331, 337
BsaJI CCNNGG 2 cut(s) 330, 336
Bsc4I CCNNNNNNNGG 4 cut(s) 77, 78, 163, 336
Bse3DI GCAATG 1 cut(s) 279
BseBI CCWGG 2 cut(s) 331, 337
BseDI CCNNGG 2 cut(s) 330, 336
BseGI GGATG 1 cut(s) 66
BseLI CCNNNNNNNGG 4 cut(s) 77, 78, 163, 336
BseMI GCAATG 1 cut(s) 279
BseMII CTCAG 1 cut(s) 32
BseXI GCAGC 2 cut(s) 179, 296
BshFI GGCC 1 cut(s) 335
BslFI GGGAC 2 cut(s) 16, 95
BslI CCNNNNNNNGG 4 cut(s) 77, 78, 163, 336
BsmFI GGGAC 2 cut(s) 16, 95
BsnI GGCC 1 cut(s) 335
Bsp143I GATC 2 cut(s) 238, 292
BspANI GGCC 1 cut(s) 335
BspCNI CTCAG 1 cut(s) 31
BsrDI GCAATG 1 cut(s) 279
BssECI CCNNGG 2 cut(s) 330, 336
BssMI GATC 2 cut(s) 238, 292
Bst2UI CCWGG 2 cut(s) 331, 337
Bst4CI ACNGT 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 2 cut(s) 241, 295
BstMBI GATC 2 cut(s) 238, 292
BstNI CCWGG 2 cut(s) 331, 337
BstSCI CCNGG 2 cut(s) 329, 335
BstV1I GCAGC 2 cut(s) 179, 296
BsuRI GGCC 1 cut(s) 335
BtsCI GGATG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 248
Cfr13I GGNCC 1 cut(s) 333
CseI GACGC 1 cut(s) 70
CviAII CATG 2 cut(s) 158, 301
CviJI RGCY 5 cut(s) 5, 170, 287, 316, 335
CviKI_1 RGCY 5 cut(s) 5, 170, 287, 316, 335
DdeI CTNAG 1 cut(s) 18
DpnI GATC 2 cut(s) 240, 294
DpnII GATC 2 cut(s) 238, 292
EcoRII CCWGG 2 cut(s) 329, 335
FaeI CATG 2 cut(s) 161, 304
FaiI YATR 6 cut(s) 53, 159, 249, 260, 302, 349
FaqI GGGAC 2 cut(s) 16, 95
FatI CATG 2 cut(s) 157, 300
FbaI TGATCA 1 cut(s) 238
Fnu4HI GCNGC 2 cut(s) 168, 285
FokI GGATG 1 cut(s) 53
Fsp4HI GCNGC 2 cut(s) 168, 285
GluI GCNGC 2 cut(s) 168, 285
HaeIII GGCC 1 cut(s) 335
HgaI GACGC 1 cut(s) 70
Hin1II CATG 2 cut(s) 161, 304
HinfI GANTC 3 cut(s) 29, 83, 203
HphI GGTGA 1 cut(s) 165
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4V TGCA 1 cut(s) 284
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 2 cut(s) 161, 304
Ksp22I TGATCA 1 cut(s) 238
Kzo9I GATC 2 cut(s) 238, 292
LpnPI CCDG 6 cut(s) 106, 141, 213, 316, 322, 343
Lsp1109I GCAGC 2 cut(s) 179, 296
MalI GATC 2 cut(s) 240, 294
MboI GATC 2 cut(s) 238, 292
MlyI GAGTC 2 cut(s) 38, 77
MnlI CCTC 7 cut(s) 27, 44, 123, 157, 162, 302, 306
MspA1I CMGCKG 1 cut(s) 287
MspR9I CCNGG 2 cut(s) 331, 337
MvaI CCWGG 2 cut(s) 331, 337
NdeII GATC 2 cut(s) 238, 292
NlaIII CATG 2 cut(s) 161, 304
PfeI GAWTC 1 cut(s) 203
PkrI GCNGC 2 cut(s) 169, 286
PleI GAGTC 2 cut(s) 37, 77
PpsI GAGTC 2 cut(s) 37, 77
Psp6I CCWGG 2 cut(s) 329, 335
PspGI CCWGG 2 cut(s) 329, 335
PspPI GGNCC 1 cut(s) 333
PvuII CAGCTG 1 cut(s) 287
SatI GCNGC 2 cut(s) 168, 285
Sau3AI GATC 2 cut(s) 238, 292
Sau96I GGNCC 1 cut(s) 333
SchI GAGTC 2 cut(s) 38, 77
ScrFI CCNGG 2 cut(s) 331, 337
SetI ASST 5 cut(s) 172, 229, 254, 289, 348
StyD4I CCNGG 2 cut(s) 329, 335
TaaI ACNGT 1 cut(s) 182
TaqI TCGA 1 cut(s) 27
TfiI GAWTC 1 cut(s) 203
TscAI CASTG 1 cut(s) 248
TseI GCWGC 2 cut(s) 167, 284
TspRI CASTG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.