RchiOBHm_Chr5g0029761

NEDD8 ultimate buster

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
23507095 .. 23508326
1232 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30912

Sequence Viewer

Length: 174 bp
ATGTCGAAGAGACATGCTGATGGTTCATTGCCAATTGAAGATTTCAACATAGTACTTGGAAATCAGAGTGGGAAGAAAGTACAAATGGGATCAGAGACTGATCAGCGGTATGATTTAATCAGGGGCAATCATGATGAGCCTGATGTTACATACCAATGCAAAGCAACTGATTAA

Protein Analysis

57

Amino Acids

6.41

Weight (kDa)

5.13

Isoelectric Point (pI)

48.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000694)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AclWI GGATC 1 cut(s) 97
AfaI GTAC 2 cut(s) 54, 81
AgsI TTSAA 2 cut(s) 38, 46
Alw26I GTCTC 2 cut(s) 4, 89
AlwI GGATC 1 cut(s) 97
AlwNI CAGNNNCTG 1 cut(s) 98
BccI CCATC 1 cut(s) 14
BclI TGATCA 1 cut(s) 100
BcoDI GTCTC 2 cut(s) 4, 89
BmcAI AGTACT 1 cut(s) 54
Bse3DI GCAATG 1 cut(s) 26
BseMI GCAATG 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 4, 89
Bsp143I GATC 2 cut(s) 89, 100
BspACI CCGC 1 cut(s) 106
BspHI TCATGA 1 cut(s) 130
BspPI GGATC 1 cut(s) 97
BsrDI GCAATG 1 cut(s) 26
BssMI GATC 2 cut(s) 89, 100
Bst6I CTCTTC 1 cut(s) 2
BstKTI GATC 2 cut(s) 92, 103
BstMAI GTCTC 2 cut(s) 4, 89
BstMBI GATC 2 cut(s) 89, 100
BstNSI RCATGY 1 cut(s) 17
CaiI CAGNNNCTG 1 cut(s) 98
CciI TCATGA 1 cut(s) 130
Csp6I GTAC 2 cut(s) 53, 80
CviAII CATG 2 cut(s) 14, 131
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
CviQI GTAC 2 cut(s) 53, 80
DpnI GATC 2 cut(s) 91, 102
DpnII GATC 2 cut(s) 89, 100
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
FaeI CATG 2 cut(s) 17, 134
FaiI YATR 5 cut(s) 15, 50, 111, 132, 151
FatI CATG 2 cut(s) 13, 130
FbaI TGATCA 1 cut(s) 100
Hin1II CATG 2 cut(s) 17, 134
Hpy188I TCNGA 2 cut(s) 66, 94
Hpy188III TCNNGA 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 159
Hsp92II CATG 2 cut(s) 17, 134
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 2 cut(s) 89, 100
LpnPI CCDG 2 cut(s) 106, 153
MaeIII GTNAC 1 cut(s) 145
MalI GATC 2 cut(s) 91, 102
MboI GATC 2 cut(s) 89, 100
MboII GAAGA 3 cut(s) 19, 50, 85
MfeI CAATTG 1 cut(s) 33
MluCI AATT 1 cut(s) 33
MseI TTAA 2 cut(s) 116, 172
MslI CAYNNNNRTG 2 cut(s) 18, 154
MspA1I CMGCKG 1 cut(s) 106
MunI CAATTG 1 cut(s) 33
NdeII GATC 2 cut(s) 89, 100
NlaIII CATG 2 cut(s) 17, 134
NspI RCATGY 1 cut(s) 17
PagI TCATGA 1 cut(s) 130
PstNI CAGNNNCTG 1 cut(s) 98
RsaI GTAC 2 cut(s) 54, 81
RsaNI GTAC 2 cut(s) 53, 80
RseI CAYNNNNRTG 2 cut(s) 18, 154
SaqAI TTAA 2 cut(s) 116, 172
Sau3AI GATC 2 cut(s) 89, 100
ScaI AGTACT 1 cut(s) 54
SgeI CNNG 5 cut(s) 26, 68, 133, 143, 152
SmiMI CAYNNNNRTG 2 cut(s) 18, 154
Sse9I AATT 1 cut(s) 33
SsiI CCGC 1 cut(s) 106
TaqI TCGA 1 cut(s) 5
TasI AATT 1 cut(s) 33
TatI WGTACW 2 cut(s) 52, 79
Tru1I TTAA 2 cut(s) 116, 172
Tru9I TTAA 2 cut(s) 116, 172
TspDTI ATGAA 1 cut(s) 15
XceI RCATGY 1 cut(s) 17
ZrmI AGTACT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.