Rmu_sc0000848.1_g000013

NEDD8 ultimate buster

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000848.1
Physical Location & Seq
Forward (+)
32624 .. 32923
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000848.1_g000013.1.cds

Sequence Viewer

Length: 300 bp
atgctgctaaccaatctgaggcaattcctgcaatcgatgccaacaacaatagccaatctgatgttgcaattaactaacattgcaaattctcttgcttcaatgcttgataatcaaattggtcaagtcggaggtccttcaacatctagtaatgcatcagagcgtgatgcagaaatggaaagccaacttgctgaagaactagcacaaggagatgctttcactgactatgacattgaagtttgtagagaagttgaagctacaagtgagtaccaggctctactgaattcagcgggaacaaagtga

Protein Analysis

99

Amino Acids

10.72

Weight (kDa)

4.05

Isoelectric Point (pI)

49.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000694)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 287
AcsI RAATTY 2 cut(s) 85, 280
AcuI CTGAAG 1 cut(s) 210
AfaI GTAC 1 cut(s) 266
AfiI CCNNNNNNNGG 1 cut(s) 18
AgsI TTSAA 4 cut(s) 99, 138, 233, 251
AjnI CCWGG 1 cut(s) 267
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 2 cut(s) 85, 280
AspS9I GGNCC 1 cut(s) 131
AvaII GGWCC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 269
BfaI CTAG 2 cut(s) 144, 197
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 269
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 269
BmsI GCATC 4 cut(s) 27, 154, 161, 199
Bsa29I ATCGAT 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 18
Bse3DI GCAATG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 269
BseCI ATCGAT 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 18
BseMI GCAATG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 8
BshVI ATCGAT 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 18
BspACI CCGC 1 cut(s) 287
BspCNI CTCAG 1 cut(s) 9
BspDI ATCGAT 1 cut(s) 35
BsrDI GCAATG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 269
BstAPI GCANNNNNTGC 2 cut(s) 28, 37
BstDEI CTNAG 1 cut(s) 17
BstMWI GCNNNNNNNGC 2 cut(s) 28, 37
BstNI CCWGG 1 cut(s) 269
BstSCI CCNGG 1 cut(s) 267
Bsu15I ATCGAT 1 cut(s) 35
BsuTUI ATCGAT 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 131
ClaI ATCGAT 1 cut(s) 35
Csp6I GTAC 1 cut(s) 265
CviJI RGCY 4 cut(s) 53, 180, 254, 272
CviKI_1 RGCY 4 cut(s) 53, 180, 254, 272
CviQI GTAC 1 cut(s) 265
DdeI CTNAG 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 210
EcoO109I RGGNCCY 1 cut(s) 131
EcoRI GAATTC 1 cut(s) 280
EcoRII CCWGG 1 cut(s) 267
EcoT22I ATGCAT 1 cut(s) 154
FaiI YATR 1 cut(s) 225
FauI CCCGC 1 cut(s) 280
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 2 cut(s) 144, 197
GluI GCNGC 1 cut(s) 5
Hpy188I TCNGA 4 cut(s) 18, 60, 128, 157
HpyAV CCTTC 1 cut(s) 144
HpyCH4V TGCA 5 cut(s) 31, 67, 83, 152, 167
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 37
HpyF3I CTNAG 1 cut(s) 17
LpnPI CCDG 3 cut(s) 41, 254, 281
LweI GCATC 4 cut(s) 27, 154, 161, 199
MaeI CTAG 2 cut(s) 144, 197
MboII GAAGA 1 cut(s) 203
MluCI AATT 5 cut(s) 23, 68, 85, 114, 280
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 2 cut(s) 12, 122
Mph1103I ATGCAT 1 cut(s) 154
MseI TTAA 1 cut(s) 71
MspA1I CMGCKG 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 269
MvaI CCWGG 1 cut(s) 269
MwoI GCNNNNNNNGC 2 cut(s) 28, 37
NsiI ATGCAT 1 cut(s) 154
PkrI GCNGC 1 cut(s) 6
PpuMI RGGWCCY 1 cut(s) 131
Psp5II RGGWCCY 1 cut(s) 131
Psp6I CCWGG 1 cut(s) 267
PspGI CCWGG 1 cut(s) 267
PspPI GGNCC 1 cut(s) 131
PspPPI RGGWCCY 1 cut(s) 131
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
SaqAI TTAA 1 cut(s) 71
SatI GCNGC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 269
SetI ASST 2 cut(s) 133, 256
SfaNI GCATC 4 cut(s) 27, 154, 161, 199
SinI GGWCC 1 cut(s) 131
Sse9I AATT 5 cut(s) 23, 68, 85, 114, 280
SsiI CCGC 1 cut(s) 287
SspMI CTAG 2 cut(s) 144, 197
StyD4I CCNGG 1 cut(s) 267
TaqI TCGA 1 cut(s) 35
TasI AATT 5 cut(s) 23, 68, 85, 114, 280
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TscAI CASTG 1 cut(s) 223
TseI GCWGC 1 cut(s) 4
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 1 cut(s) 131
XapI RAATTY 2 cut(s) 85, 280
XspI CTAG 2 cut(s) 144, 197
Zsp2I ATGCAT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.