Rmu_sc0000689.1_g000025

NEDD8 ultimate buster

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000689.1
Physical Location & Seq
Reverse (-)
94826 .. 95236
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000689.1_g000025.1.cds

Sequence Viewer

Length: 411 bp
atgtttgtgaggccaaatcgtgctcactctgatgtttacaactttgtgttcaacagtcttagctttgcagggtggagggacaatggaccaagcaatctgtcaactgctctcgggacatcaccaaaccccacagatgctgctgaccaatctgaggcaattcctgcagtcaatgctaacaacaatagtcaatctgatgttgcaattgacattgcaaattctcttgcgtcaatgcttgataatcaaaatggtcaagttggaggtccttcaacgcctagtattgcatcagagcgtgaacttgctgaagaactagcacaaggagatgctttcactgactacgatattgaagataccagaaaaggtgaagtcataagtgagaacttggctctactgaattcagcgggaacaaagtga

Protein Analysis

136

Amino Acids

14.36

Weight (kDa)

4.09

Isoelectric Point (pI)

32.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000694)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 398
AcsI RAATTY 2 cut(s) 214, 391
AcuI CTGAAG 1 cut(s) 321
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 3 cut(s) 52, 267, 344
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw21I GWGCWC 1 cut(s) 25
AlwNI CAGNNNCTG 1 cut(s) 137
Ama87I CYCGRG 1 cut(s) 110
AoxI GGCC 1 cut(s) 11
ApeKI GCWGC 1 cut(s) 137
ApoI RAATTY 2 cut(s) 214, 391
AspS9I GGNCC 2 cut(s) 86, 260
AsuHPI GGTGA 2 cut(s) 111, 371
AvaI CYCGRG 1 cut(s) 110
AvaII GGWCC 2 cut(s) 86, 260
Bbv12I GWGCWC 1 cut(s) 25
BbvI GCAGC 1 cut(s) 124
BfaI CTAG 2 cut(s) 273, 308
BfmI CTRYAG 1 cut(s) 162
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
Bme18I GGWCC 2 cut(s) 86, 260
BmeT110I CYCGRG 1 cut(s) 110
BmgT120I GGNCC 2 cut(s) 86, 260
BmsI GCATC 3 cut(s) 124, 290, 310
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse3DI GCAATG 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 124
BshFI GGCC 1 cut(s) 13
BsiHKAI GWGCWC 1 cut(s) 25
BsiHKCI CYCGRG 1 cut(s) 110
BslFI GGGAC 2 cut(s) 92, 127
BslI CCNNNNNNNGG 1 cut(s) 151
BsmFI GGGAC 2 cut(s) 92, 127
BsnI GGCC 1 cut(s) 13
BsoBI CYCGRG 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 25
BspACI CCGC 1 cut(s) 398
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 142
BspMAI CTGCAG 1 cut(s) 166
BsrDI GCAATG 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 56
BstAPI GCANNNNNTGC 2 cut(s) 161, 170
BstDEI CTNAG 2 cut(s) 59, 150
BstMWI GCNNNNNNNGC 2 cut(s) 161, 170
BstSFI CTRYAG 1 cut(s) 162
BstV1I GCAGC 1 cut(s) 124
BsuRI GGCC 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 327
CaiI CAGNNNCTG 1 cut(s) 137
Cfr13I GGNCC 2 cut(s) 86, 260
CseI GACGC 1 cut(s) 213
CviJI RGCY 3 cut(s) 13, 63, 383
CviKI_1 RGCY 3 cut(s) 13, 63, 383
DdeI CTNAG 2 cut(s) 59, 150
Eco47I GGWCC 2 cut(s) 86, 260
Eco57I CTGAAG 1 cut(s) 321
Eco88I CYCGRG 1 cut(s) 110
EcoO109I RGGNCCY 1 cut(s) 260
EcoRI GAATTC 1 cut(s) 391
FaiI YATR 1 cut(s) 368
FaqI GGGAC 2 cut(s) 92, 127
FauI CCCGC 1 cut(s) 391
Fnu4HI GCNGC 1 cut(s) 138
Fsp4HI GCNGC 1 cut(s) 138
FspBI CTAG 2 cut(s) 273, 308
GluI GCNGC 1 cut(s) 138
HaeIII GGCC 1 cut(s) 13
HgaI GACGC 1 cut(s) 213
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HphI GGTGA 2 cut(s) 111, 371
Hpy166II GTNNAC 3 cut(s) 37, 102, 293
Hpy188I TCNGA 4 cut(s) 31, 151, 193, 286
Hpy188III TCNNGA 1 cut(s) 112
Hpy8I GTNNAC 3 cut(s) 37, 102, 293
HpyAV CCTTC 1 cut(s) 273
HpyCH4III ACNGT 1 cut(s) 56
HpyCH4V TGCA 5 cut(s) 68, 164, 200, 212, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 161, 170
HpyF3I CTNAG 2 cut(s) 59, 150
LpnPI CCDG 3 cut(s) 54, 174, 364
Lsp1109I GCAGC 1 cut(s) 124
LweI GCATC 3 cut(s) 124, 290, 310
MaeI CTAG 2 cut(s) 273, 308
MboII GAAGA 2 cut(s) 314, 356
MfeI CAATTG 1 cut(s) 201
MhlI GDGCHC 1 cut(s) 25
MluCI AATT 4 cut(s) 156, 201, 214, 391
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 4 cut(s) 3, 69, 145, 251
MslI CAYNNNNRTG 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 398
MunI CAATTG 1 cut(s) 201
MwoI GCNNNNNNNGC 2 cut(s) 161, 170
PkrI GCNGC 1 cut(s) 139
PpuMI RGGWCCY 1 cut(s) 260
Psp5II RGGWCCY 1 cut(s) 260
PspPI GGNCC 2 cut(s) 86, 260
PspPPI RGGWCCY 1 cut(s) 260
PstI CTGCAG 1 cut(s) 166
PstNI CAGNNNCTG 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 30
SatI GCNGC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 86, 260
SduI GDGCHC 1 cut(s) 25
SetI ASST 3 cut(s) 65, 262, 361
SfaNI GCATC 3 cut(s) 124, 290, 310
SfcI CTRYAG 1 cut(s) 162
SinI GGWCC 2 cut(s) 86, 260
SmiMI CAYNNNNRTG 1 cut(s) 30
Sse9I AATT 4 cut(s) 156, 201, 214, 391
SsiI CCGC 1 cut(s) 398
SspMI CTAG 2 cut(s) 273, 308
TaaI ACNGT 1 cut(s) 56
TasI AATT 4 cut(s) 156, 201, 214, 391
TscAI CASTG 1 cut(s) 334
TseI GCWGC 1 cut(s) 137
TspRI CASTG 1 cut(s) 334
VpaK11BI GGWCC 2 cut(s) 86, 260
XapI RAATTY 2 cut(s) 214, 391
XspI CTAG 2 cut(s) 273, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.