Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0000694

Physical Location & Seq

Genomic Coordinates Forward (+)

67483345 .. 67483792

Gene Structure 448 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ21629

Sequence Viewer

CDS Protein Promoter (2k)

Length: 132 bp

ATGGAAGTGCTCAGCATGGAGGAGGAGGCTTTCTCTCTCTGCGATCCATCGGTTATTAAGCTGGTCGATAATCCTTCTATACTGCAAATCGATATGGTTTGGTGTTATTTCATGCTTAGAGACATAAACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005829 GO:0006464 GO:0006508 GO:0006511 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009893 GO:0009894 GO:0009896 GO:0009987 GO:0010604 GO:0016567 GO:0019222 GO:0019538 GO:0019941 GO:0030162 GO:0030163 GO:0031323 GO:0031325 GO:0031329 GO:0031331 GO:0031974 GO:0031981 GO:0032268 GO:0032270 GO:0032434 GO:0032436 GO:0032446 GO:0036211 GO:0042176 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043412 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0045732 GO:0045862 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051246 GO:0051247 GO:0051603 GO:0060255 GO:0061136 GO:0065007 GO:0070013 GO:0070647 GO:0071704 GO:0080090 GO:1901564 GO:1901565 GO:1901575 GO:1901800 GO:1903050 GO:1903052 GO:1903362 GO:1903364 GO:2000058 GO:2000060

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UBA ubiquitin

Protein Analysis

43

Amino Acids

5.04

Weight (kDa)

4.05

Isoelectric Point (pI)

46.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000694)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0314531 RchiOBHm_Chr1g0314541 RchiOBHm_Chr1g0314551 RchiOBHm_Chr1g0341141 RchiOBHm_Chr1g0341151 RchiOBHm_Chr2g0147321 RchiOBHm_Chr2g0147341 RchiOBHm_Chr5g0016131 RchiOBHm_Chr5g0016141 RchiOBHm_Chr5g0016151 RchiOBHm_Chr5g0016251 RchiOBHm_Chr5g0029761 RchiOBHm_Chr5g0061311 RchiOBHm_Chr5g0069491 RchiOBHm_Chr5g0072041 RchiOBHm_Chr5g0072051 RchiOBHm_Chr5g0079831 RchiOBHm_Chr7g0226011 RchiOBHm_Chr7g0241351 RchiOBHm_Chr7g0241361 RchiOBHm_Chr7g0241381
rosa_laevigata	RLG00000012856 RLG00000014927 RLG00000036057 RLG00000036066 RLG00000036073
rosa_multiflora	Rmu_co8366475.1_g000001 Rmu_sc0000281.1_g000023 Rmu_sc0000689.1_g000025 Rmu_sc0000689.1_g000026 Rmu_sc0000848.1_g000013 Rmu_sc0001264.1_g000010 Rmu_sc0002132.1_g000040 Rmu_sc0003241.1_g000001 Rmu_sc0007385.1_g000008 Rmu_sc0007385.1_g000015 Rmu_sc0010665.1_g000021 Rmu_sc0015027.1_g000003 Rmu_sc0021542.1_g000001 Rmu_sc0023463.1_g000002 Rmu_sc0031947.1_g000001
rosa_roxburghii	Rroxscaffold_1G00011470 Rroxscaffold_1G00057460 Rroxscaffold_2G00135270 Rroxscaffold_3G00255510 Rroxscaffold_5G00365380
rosa_rugosa	Rorug07G0218300
rosa_samantha	Rh1AG011200 Rh1AG011300 Rh2BG272300 Rh2BG272400 Rh2BG536800 Rh3DG285000 Rh3DG285100 Rh4AG250800 Rh4BG145100 Rh5BG183100 Rh5BG474300 Rh5CG135400 Rh5CG135800 Rh5CG135900 Rh5CG496700 Rh5CG497800 Rh6AG068300 Rh6AG140800 Rh7BG191500 Rh7CG198900 Rh7CG436200 Rh7CG436300
rosa_wichuraiana	Rw1G023280 Rw2G052210 Rw6G005990 Rw6G021050 Rw7G010560 Rw7G042590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	38
AluBI	AGCT	1 cut(s)	61
AluI	AGCT	1 cut(s)	61
Alw21I	GWGCWC	1 cut(s)	12
Alw26I	GTCTC	1 cut(s)	114
AlwI	GGATC	1 cut(s)	38
Bbv12I	GWGCWC	1 cut(s)	12
BccI	CCATC	1 cut(s)	55
BcoDI	GTCTC	1 cut(s)	114
BfaI	CTAG	1 cut(s)	130
BlpI	GCTNAGC	1 cut(s)	11
BplI	GAGNNNNNCTC	2 cut(s)	17, 49
Bpu1102I	GCTNAGC	1 cut(s)	11
Bsa29I	ATCGAT	1 cut(s)	90
BseCI	ATCGAT	1 cut(s)	90
BseMII	CTCAG	1 cut(s)	25
BseRI	GAGGAG	2 cut(s)	35, 38
BshVI	ATCGAT	1 cut(s)	90
BsiHKAI	GWGCWC	1 cut(s)	12
BsmAI	GTCTC	1 cut(s)	114
Bsp1286I	GDGCHC	1 cut(s)	12
Bsp143I	GATC	1 cut(s)	43
Bsp1720I	GCTNAGC	1 cut(s)	11
BspCNI	CTCAG	1 cut(s)	24
BspDI	ATCGAT	1 cut(s)	90
BspPI	GGATC	1 cut(s)	38
BssMI	GATC	1 cut(s)	43
BstDEI	CTNAG	2 cut(s)	11, 116
BstKTI	GATC	1 cut(s)	46
BstMAI	GTCTC	1 cut(s)	114
BstMBI	GATC	1 cut(s)	43
Bsu15I	ATCGAT	1 cut(s)	90
BsuTUI	ATCGAT	1 cut(s)	90
ClaI	ATCGAT	1 cut(s)	90
CviAII	CATG	2 cut(s)	16, 112
CviJI	RGCY	2 cut(s)	29, 61
CviKI_1	RGCY	2 cut(s)	29, 61
DdeI	CTNAG	2 cut(s)	11, 116
DpnI	GATC	1 cut(s)	45
DpnII	GATC	1 cut(s)	43
FaeI	CATG	2 cut(s)	19, 115
FaiI	YATR	5 cut(s)	17, 80, 95, 113, 125
FatI	CATG	2 cut(s)	15, 111
FspBI	CTAG	1 cut(s)	130
Hin1II	CATG	2 cut(s)	19, 115
HpyAV	CCTTC	1 cut(s)	84
HpyCH4V	TGCA	1 cut(s)	85
HpyF3I	CTNAG	2 cut(s)	11, 116
Hsp92II	CATG	2 cut(s)	19, 115
Kzo9I	GATC	1 cut(s)	43
LpnPI	CCDG	1 cut(s)	47
MaeI	CTAG	1 cut(s)	130
MalI	GATC	1 cut(s)	45
MboI	GATC	1 cut(s)	43
MhlI	GDGCHC	1 cut(s)	12
MnlI	CCTC	3 cut(s)	13, 16, 19
MseI	TTAA	1 cut(s)	57
NdeII	GATC	1 cut(s)	43
NlaIII	CATG	2 cut(s)	19, 115
SaqAI	TTAA	1 cut(s)	57
Sau3AI	GATC	1 cut(s)	43
SduI	GDGCHC	1 cut(s)	12
SetI	ASST	1 cut(s)	63
SgeI	CNNG	3 cut(s)	28, 74, 124
SspMI	CTAG	1 cut(s)	130
TaqI	TCGA	2 cut(s)	66, 90
Tru1I	TTAA	1 cut(s)	57
Tru9I	TTAA	1 cut(s)	57
TspDTI	ATGAA	1 cut(s)	100
XspI	CTAG	1 cut(s)	130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.