RchiOBHm_Chr4g0433831

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000349
Physical Location & Seq
Forward (+)
57804288 .. 57804440
153 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40230

Sequence Viewer

Length: 153 bp
ATGAACCATAATCTCTCAGAAATCCAAGACATGGAAGAAGCCAGTACTGAAATTGAAGCCCCAAATTCAAACCCTAATCAAATCCTAAATGATCTACTTGACGAAATCTGGATCCAAATCCTCTCCTTGATTCTGACCTTGGAGGCCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.69

Weight (kDa)

4.05

Isoelectric Point (pI)

66.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000349)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G43415
fragaria_vesca FvH4_1g28610 FvH4_6g43940 FvH4_6g43940 FvH4_6g43940 FvH4_6g43950 FvH4_6g43960 FvH4_6g43970 FvH4_6g43990 FvH4_6g44000 FvH4_7g14510
malus_domestica MD09G1101800.v1.1 MD17G1089200.v1.1 MD17G1089300.v1.1 MD17G1089400.v1.1 MD17G1089500.v1.1 MD17G1089600.v1.1
prunus_persica Prupe.3G223900_v2.0.a1 Prupe.3G223900_v2.0.a1 Prupe.3G224000_v2.0.a1 Prupe.3G224100_v2.0.a1 Prupe.3G224200_v2.0.a1
pyrus_communis pycom09g02550 pycom17g02610 pycom17g08610 pycom17g08620 pycom17g08630 pycom17g08640 pycom17g08670
rosa_chinensis RchiOBHm_Chr2g0160711 RchiOBHm_Chr2g0160721 RchiOBHm_Chr2g0160731 RchiOBHm_Chr2g0160741 RchiOBHm_Chr4g0433831 RchiOBHm_Chr7g0197991
rosa_laevigata RLG00000001614 RLG00000002340 RLG00000003895 RLG00000005223 RLG00000021235 RLG00000021236 RLG00000021237 RLG00000021238 RLG00000028664 RLG00000029542 RLG00000029654 RLG00000035034
rosa_multiflora Rmu_co8177938.1_g000001 Rmu_co8474907.1_g000002 Rmu_sc0000064.1_g000011 Rmu_sc0000221.1_g000038 Rmu_sc0002773.1_g000001 Rmu_sc0002773.1_g000004 Rmu_sc0002773.1_g000006 Rmu_sc0002773.1_g000008 Rmu_sc0003465.1_g000005 Rmu_sc0006325.1_g000010 Rmu_sc0024525.1_g000002 Rmu_sc0030848.1_g000001 Rmu_sc0030848.1_g000002 Rmu_sc0030848.1_g000004
rosa_roxburghii Rroxscaffold_2G00089410 Rroxscaffold_2G00089420 Rroxscaffold_2G00089430 Rroxscaffold_2G00089450 Rroxscaffold_2G00089460 Rroxscaffold_3G00258030 Rroxscaffold_5G00351500
rosa_rugosa Rorug02G0485200 Rorug02G0485400 Rorug02G0485500 Rorug02G0485600 Rorug06G0149200
rosa_samantha Rh1AG011000 Rh2AG501800 Rh2AG550200 Rh2AG550300 Rh2AG550400 Rh2AG550500 Rh2BG217000 Rh2BG564800 Rh2BG564900 Rh2BG565000 Rh2BG565100 Rh2BG607100 Rh2CG487700 Rh2CG534600 Rh2CG534700 Rh2CG534800 Rh2CG534900 Rh2DG573500 Rh2DG573600 Rh2DG574000 Rh2DG574100 Rh3CG290600 Rh7AG168600 Rh7BG171600 Rh7BG171700 Rh7CG178100 Rh7DG170700 Rh7DG170900
rosa_wichuraiana Rw2G022070 Rw2G045590 Rw2G045600 Rw2G045610 Rw2G045620 Rw3G021600 Rw7G014730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 31
AclWI GGATC 2 cut(s) 106, 119
AcsI RAATTY 1 cut(s) 64
AfaI GTAC 1 cut(s) 46
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 2 cut(s) 56, 69
AlwI GGATC 2 cut(s) 106, 119
AoxI GGCC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 64
BamHI GGATCC 1 cut(s) 111
BfaI CTAG 1 cut(s) 151
BmcAI AGTACT 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 113
BsaBI GATNNNNATC 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 42
Bse8I GATNNNNATC 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 138
BseJI GATNNNNATC 1 cut(s) 116
BseLI CCNNNNNNNGG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 42
BshFI GGCC 1 cut(s) 146
BslI CCNNNNNNNGG 1 cut(s) 31
BsnI GGCC 1 cut(s) 146
Bsp143I GATC 2 cut(s) 91, 111
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 113
BspPI GGATC 2 cut(s) 106, 119
BsrI ACTGG 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 2 cut(s) 91, 111
BssT1I CCWWGG 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 16
BstKTI GATC 2 cut(s) 94, 114
BstMBI GATC 2 cut(s) 91, 111
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BsuRI GGCC 1 cut(s) 146
Csp6I GTAC 1 cut(s) 45
CviAII CATG 1 cut(s) 31
CviJI RGCY 3 cut(s) 41, 59, 146
CviKI_1 RGCY 3 cut(s) 41, 59, 146
CviQI GTAC 1 cut(s) 45
DdeI CTNAG 1 cut(s) 16
DpnI GATC 2 cut(s) 93, 113
DpnII GATC 2 cut(s) 91, 111
Eco130I CCWWGG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 9, 32
FatI CATG 1 cut(s) 30
FspBI CTAG 1 cut(s) 151
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 1 cut(s) 34
HinfI GANTC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 19, 135
Hpy188III TCNNGA 1 cut(s) 109
HpyF3I CTNAG 1 cut(s) 16
Hsp92II CATG 1 cut(s) 34
Kzo9I GATC 2 cut(s) 91, 111
LpnPI CCDG 2 cut(s) 55, 94
MaeI CTAG 1 cut(s) 151
MalI GATC 2 cut(s) 93, 113
MboI GATC 2 cut(s) 91, 111
MboII GAAGA 1 cut(s) 47
MflI RGATCY 1 cut(s) 111
MluCI AATT 2 cut(s) 51, 64
MnlI CCTC 2 cut(s) 131, 136
NdeII GATC 2 cut(s) 91, 111
NlaIII CATG 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 113
PfeI GAWTC 1 cut(s) 130
PflMI CCANNNNNTGG 1 cut(s) 31
PspN4I GGNNCC 1 cut(s) 113
PsuI RGATCY 1 cut(s) 111
RsaI GTAC 1 cut(s) 46
RsaNI GTAC 1 cut(s) 45
Sau3AI GATC 2 cut(s) 91, 111
ScaI AGTACT 1 cut(s) 46
SetI ASST 1 cut(s) 140
SgeI CNNG 6 cut(s) 38, 43, 54, 110, 121, 139
Sse9I AATT 2 cut(s) 51, 64
SspMI CTAG 1 cut(s) 151
StyI CCWWGG 1 cut(s) 138
TasI AATT 2 cut(s) 51, 64
TatI WGTACW 1 cut(s) 44
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 31
XapI RAATTY 1 cut(s) 64
XspI CTAG 1 cut(s) 151
ZrmI AGTACT 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.