Rh4CG242400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0000613
Physical Location & Seq
Reverse (-)
48913345 .. 48916378
3034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG242400.1

Sequence Viewer

Length: 234 bp
ATGGATATTCACATGTCAATGTGCCGGGTCCAAGATGAGGCTGCTCCACCTGATGAAGTTAGCAAAGACATTGGTTTTGTCATGGAAGATGAAAAAATAATTGTAGCTGAGTTGGGCAGTAAATGGGCATTGATCAAACTAAATATATTAGGAGGGGATTCCAGAATCAGCATTTATCACACAGATAACAACGTTGTATACGATCATATCGACAACATATGTGACCTCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.68

Weight (kDa)

4.37

Isoelectric Point (pI)

51.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 198
AclI AACGTT 1 cut(s) 192
AfiI CCNNNNNNNGG 1 cut(s) 37
AflIII ACRYGT 1 cut(s) 12
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
ApeKI GCWGC 1 cut(s) 41
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspS9I GGNCC 1 cut(s) 28
AsuC2I CCSGG 1 cut(s) 26
AvaII GGWCC 1 cut(s) 28
BbvI GCAGC 1 cut(s) 28
BclI TGATCA 1 cut(s) 132
BcnI CCSGG 1 cut(s) 26
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 26
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 29
BmrFI CCNGG 1 cut(s) 26
BpuMI CCSGG 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 37
BseMII CTCAG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 28
BsiSI CCGG 1 cut(s) 25
BslI CCNNNNNNNGG 1 cut(s) 37
Bsp143I GATC 2 cut(s) 132, 202
BspCNI CTCAG 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 29
BssMI GATC 2 cut(s) 132, 202
BssNAI GTATAC 1 cut(s) 199
Bst1107I GTATAC 1 cut(s) 199
BstDEI CTNAG 1 cut(s) 108
BstKTI GATC 2 cut(s) 135, 205
BstMBI GATC 2 cut(s) 132, 202
BstNSI RCATGY 1 cut(s) 16
BstSCI CCNGG 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 28
BstZ17I GTATAC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 28
CviAII CATG 2 cut(s) 13, 82
CviJI RGCY 2 cut(s) 41, 107
CviKI_1 RGCY 2 cut(s) 41, 107
DdeI CTNAG 1 cut(s) 108
DpnI GATC 2 cut(s) 134, 204
DpnII GATC 2 cut(s) 132, 202
Eco47I GGWCC 1 cut(s) 28
FaeI CATG 2 cut(s) 16, 85
FaiI YATR 7 cut(s) 14, 83, 146, 199, 207, 218, 220
FatI CATG 2 cut(s) 12, 81
FauNDI CATATG 1 cut(s) 218
FbaI TGATCA 1 cut(s) 132
FblI GTMKAC 1 cut(s) 198
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
GluI GCNGC 1 cut(s) 42
HapII CCGG 1 cut(s) 25
Hin1II CATG 2 cut(s) 16, 85
HinfI GANTC 2 cut(s) 158, 165
HpaII CCGG 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 162
Hpy8I GTNNAC 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 192
HpyF3I CTNAG 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 192
Hsp92II CATG 2 cut(s) 16, 85
Ksp22I TGATCA 1 cut(s) 132
Kzo9I GATC 2 cut(s) 132, 202
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 3 cut(s) 38, 63, 175
Lsp1109I GCAGC 1 cut(s) 28
MaeII ACGT 1 cut(s) 192
MaeIII GTNAC 1 cut(s) 221
MalI GATC 2 cut(s) 134, 204
MboI GATC 2 cut(s) 132, 202
MboII GAAGA 1 cut(s) 98
MluCI AATT 2 cut(s) 99, 229
MnlI CCTC 2 cut(s) 31, 146
MseI TTAA 1 cut(s) 232
MslI CAYNNNNRTG 1 cut(s) 17
MspI CCGG 1 cut(s) 25
MspR9I CCNGG 1 cut(s) 26
NciI CCSGG 1 cut(s) 26
NdeI CATATG 1 cut(s) 218
NdeII GATC 2 cut(s) 132, 202
NlaIII CATG 2 cut(s) 16, 85
NlaIV GGNNCC 1 cut(s) 29
NmuCI GTSAC 1 cut(s) 221
NspI RCATGY 1 cut(s) 16
PciI ACATGT 1 cut(s) 12
PcsI WCGNNNNNNNCGW 2 cut(s) 198, 207
PfeI GAWTC 2 cut(s) 158, 165
PkrI GCNGC 1 cut(s) 43
PscI ACATGT 1 cut(s) 12
Psp1406I AACGTT 1 cut(s) 192
PspN4I GGNNCC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 17
SaqAI TTAA 1 cut(s) 232
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 2 cut(s) 132, 202
Sau96I GGNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 26
SetI ASST 4 cut(s) 52, 109, 195, 228
SgeI CNNG 7 cut(s) 25, 37, 38, 44, 62, 94, 174
SinI GGWCC 1 cut(s) 28
SmiMI CAYNNNNRTG 1 cut(s) 17
Sse9I AATT 2 cut(s) 99, 229
StyD4I CCNGG 1 cut(s) 24
TaiI ACGT 1 cut(s) 195
TaqI TCGA 1 cut(s) 210
TasI AATT 2 cut(s) 99, 229
TfiI GAWTC 2 cut(s) 158, 165
Tru1I TTAA 1 cut(s) 232
Tru9I TTAA 1 cut(s) 232
TseFI GTSAC 1 cut(s) 221
TseI GCWGC 1 cut(s) 41
Tsp45I GTSAC 1 cut(s) 221
TspDTI ATGAA 2 cut(s) 69, 105
VpaK11BI GGWCC 1 cut(s) 28
XceI RCATGY 1 cut(s) 16
XmiI GTMKAC 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.