MD03G1177400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0000705
Physical Location & Seq
Reverse (-)
24435164 .. 24438679
3516 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1177400.v1.1.491

Sequence Viewer

Length: 258 bp
ATGGAGAAGCTTACCAAACAATTGGCCGAAACAGATAACAGAAAGGCGAAAATTGCAGAAAGAAAGGTAAAGGTGATGGAGGAAGCGAATGAAAGGAAGCAAAGAGAGCATGATGACCGAATTATGAGTATAGACACCACCAACATGGAGCCACGCACAAGGGCTTACTACGAGCAGCGAAAGAATCATGTTTCTTTCAAAACTATGGCACACATTAAAGACCCCTCCAATATGGATCTTCACACGATAGCTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

10.17

Weight (kDa)

9.3

Isoelectric Point (pI)

22.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 243
AcoI YGGCCR 1 cut(s) 24
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 2 cut(s) 10, 251
AluI AGCT 2 cut(s) 10, 251
AlwI GGATC 1 cut(s) 243
AoxI GGCC 1 cut(s) 24
ApeKI GCWGC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 85
BbvI GCAGC 1 cut(s) 187
BccI CCATC 1 cut(s) 70
BfaI CTAG 1 cut(s) 256
BisI GCNGC 1 cut(s) 176
BlsI GCNGC 1 cut(s) 177
BmiI GGNNCC 1 cut(s) 150
BseXI GCAGC 1 cut(s) 187
BshFI GGCC 1 cut(s) 26
BsnI GGCC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 235
BspANI GGCC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 150
BspPI GGATC 1 cut(s) 243
BssMI GATC 1 cut(s) 235
BstKTI GATC 1 cut(s) 238
BstMBI GATC 1 cut(s) 235
BstMWI GCNNNNNNNGC 2 cut(s) 53, 106
BstV1I GCAGC 1 cut(s) 187
BstX2I RGATCY 1 cut(s) 235
BstXI CCANNNNNNTGG 2 cut(s) 22, 145
BstYI RGATCY 1 cut(s) 235
BsuRI GGCC 1 cut(s) 26
CviAII CATG 3 cut(s) 110, 145, 188
CviJI RGCY 5 cut(s) 10, 26, 151, 164, 251
CviKI_1 RGCY 5 cut(s) 10, 26, 151, 164, 251
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
EaeI YGGCCR 1 cut(s) 24
FaeI CATG 3 cut(s) 113, 148, 191
FaiI YATR 7 cut(s) 111, 125, 131, 146, 189, 206, 233
FatI CATG 3 cut(s) 109, 144, 187
Fnu4HI GCNGC 1 cut(s) 176
Fsp4HI GCNGC 1 cut(s) 176
FspBI CTAG 1 cut(s) 256
GluI GCNGC 1 cut(s) 176
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 3 cut(s) 113, 148, 191
HindIII AAGCTT 1 cut(s) 8
HinfI GANTC 1 cut(s) 184
HphI GGTGA 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 2 cut(s) 53, 106
Hsp92II CATG 3 cut(s) 113, 148, 191
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 148
Lsp1109I GCAGC 1 cut(s) 187
MaeI CTAG 1 cut(s) 256
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 1 cut(s) 230
MfeI CAATTG 1 cut(s) 20
MflI RGATCY 1 cut(s) 235
MluCI AATT 3 cut(s) 20, 51, 120
MnlI CCTC 2 cut(s) 73, 235
MseI TTAA 1 cut(s) 216
MslI CAYNNNNRTG 1 cut(s) 143
MunI CAATTG 1 cut(s) 20
MwoI GCNNNNNNNGC 2 cut(s) 53, 106
NdeII GATC 1 cut(s) 235
NlaIII CATG 3 cut(s) 113, 148, 191
NlaIV GGNNCC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 184
PkrI GCNGC 1 cut(s) 177
PspN4I GGNNCC 1 cut(s) 150
PsuI RGATCY 1 cut(s) 235
RseI CAYNNNNRTG 1 cut(s) 143
SaqAI TTAA 1 cut(s) 216
SatI GCNGC 1 cut(s) 176
Sau3AI GATC 1 cut(s) 235
SetI ASST 4 cut(s) 12, 69, 75, 253
SgeI CNNG 6 cut(s) 122, 157, 165, 171, 184, 200
SmiMI CAYNNNNRTG 1 cut(s) 143
Sse9I AATT 3 cut(s) 20, 51, 120
SspMI CTAG 1 cut(s) 256
TaqII GACCGA 1 cut(s) 132
TasI AATT 3 cut(s) 20, 51, 120
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TseI GCWGC 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 105
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.