Rw7G034950
MYB Family

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0000705
Physical Location & Seq
Forward (+)
52058551 .. 52060271
1721 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G034950.1

Sequence Viewer

Length: 630 bp
ATGTCCACTCTTTCTCTCAAAGATGTGAATTGGACAAGAAAAGAAGATGAAACTCTTTGTGTTACATGTATGAAAGTATCCGAAAATTCTACAAAAGGTAATGGCAAAAAGGGAAACGGCATTTGGAAACAAGTGGAGCGAAAATTAATTGATGGCTTCAATGACAATCCTTCAAATGCAAGATCAGATGAAAGTTGTAAGTCTCGATGGCAAAAATTTCTCTTTCCATACATGAATAATTGCTACGATTTGTGTAAAGATTTGGTGACATTTGACACACCCTCACAAGATCATTTTGATGATGATGATCCTGTCGATAGTAATTCAACACCAACTTCATTTAGGGATCCGATTCCTAGGCCGATGGGAAGAAATGTCGCAAGAAGAAAGCAAATCAAGGACCAAGAAAAGGAGAATAAAACCTTTGAAGATAAGTTATTAGCTCGCATGGATCGATTGACTGAAGGAGAAGATGAAGGAGGATCGACGAGAGAGAGAGATAGAGAAGAAGCTATTTTAATGATGCAAACCGTTAATTTTACTCCAAAGAGCAAGGCTTATTTTGATGGGAAAAAAAGAGAAGCACTTGAAAACCAATTTCGTCCCTTACTCTTATTTGTATTAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_4 NAM-associated

Protein Analysis

209

Amino Acids

24.28

Weight (kDa)

6.03

Isoelectric Point (pI)

37.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 302, 341, 354, 459, 490
AcsI RAATTY 2 cut(s) 85, 215
AcuI CTGAAG 1 cut(s) 483
AfiI CCNNNNNNNGG 1 cut(s) 409
AflIII ACRYGT 1 cut(s) 65
AgsI TTSAA 5 cut(s) 160, 174, 327, 428, 590
AjuI GAANNNNNNNTTGG 2 cut(s) 106, 138
AluBI AGCT 2 cut(s) 443, 512
AluI AGCT 2 cut(s) 443, 512
Alw26I GTCTC 1 cut(s) 207
AlwI GGATC 5 cut(s) 302, 341, 354, 459, 490
AoxI GGCC 1 cut(s) 359
ApoI RAATTY 2 cut(s) 85, 215
AseI ATTAAT 2 cut(s) 146, 623
AspA2I CCTAGG 1 cut(s) 356
AspS9I GGNCC 1 cut(s) 400
AsuHPI GGTGA 1 cut(s) 277
AvaII GGWCC 1 cut(s) 400
AvrII CCTAGG 1 cut(s) 356
BamHI GGATCC 1 cut(s) 346
BccI CCATC 4 cut(s) 146, 201, 358, 560
BceAI ACGGC 1 cut(s) 133
BciVI GTATCC 1 cut(s) 88
BcoDI GTCTC 1 cut(s) 207
BfaI CTAG 1 cut(s) 357
BfuI GTATCC 1 cut(s) 88
BlnI CCTAGG 1 cut(s) 356
Bme18I GGWCC 1 cut(s) 400
BmgT120I GGNCC 1 cut(s) 400
BmiI GGNNCC 1 cut(s) 348
BmsI GCATC 1 cut(s) 513
Bsa29I ATCGAT 1 cut(s) 454
BsaBI GATNNNNATC 1 cut(s) 306
BsaJI CCNNGG 1 cut(s) 356
Bsc4I CCNNNNNNNGG 1 cut(s) 409
Bse8I GATNNNNATC 1 cut(s) 306
BseCI ATCGAT 1 cut(s) 454
BseDI CCNNGG 1 cut(s) 356
BseJI GATNNNNATC 1 cut(s) 306
BseLI CCNNNNNNNGG 1 cut(s) 409
BshFI GGCC 1 cut(s) 361
BshVI ATCGAT 1 cut(s) 454
BslFI GGGAC 1 cut(s) 588
BslI CCNNNNNNNGG 1 cut(s) 409
BsmAI GTCTC 1 cut(s) 207
BsmFI GGGAC 1 cut(s) 588
BsnI GGCC 1 cut(s) 361
Bsp143I GATC 6 cut(s) 182, 289, 307, 346, 451, 482
BspANI GGCC 1 cut(s) 361
BspDI ATCGAT 1 cut(s) 454
BspLI GGNNCC 1 cut(s) 348
BspPI GGATC 5 cut(s) 302, 341, 354, 459, 490
BssECI CCNNGG 1 cut(s) 356
BssMI GATC 6 cut(s) 182, 289, 307, 346, 451, 482
BssT1I CCWWGG 1 cut(s) 356
Bst4CI ACNGT 1 cut(s) 532
BstC8I GCNNGC 1 cut(s) 445
BstKTI GATC 6 cut(s) 185, 292, 310, 349, 454, 485
BstMAI GTCTC 1 cut(s) 207
BstMBI GATC 6 cut(s) 182, 289, 307, 346, 451, 482
BstNSI RCATGY 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 346
BstYI RGATCY 1 cut(s) 346
Bsu15I ATCGAT 1 cut(s) 454
BsuI GTATCC 1 cut(s) 88
BsuRI GGCC 1 cut(s) 361
BsuTUI ATCGAT 1 cut(s) 454
Cac8I GCNNGC 1 cut(s) 445
Cfr13I GGNCC 1 cut(s) 400
ClaI ATCGAT 1 cut(s) 454
CviAII CATG 3 cut(s) 66, 232, 448
CviJI RGCY 5 cut(s) 156, 361, 443, 512, 557
CviKI_1 RGCY 5 cut(s) 156, 361, 443, 512, 557
DpnI GATC 6 cut(s) 184, 291, 309, 348, 453, 484
DpnII GATC 6 cut(s) 182, 289, 307, 346, 451, 482
Eco130I CCWWGG 1 cut(s) 356
Eco47I GGWCC 1 cut(s) 400
Eco57I CTGAAG 1 cut(s) 483
EcoT14I CCWWGG 1 cut(s) 356
ErhI CCWWGG 1 cut(s) 356
FaeI CATG 3 cut(s) 69, 235, 451
FaiI YATR 5 cut(s) 67, 71, 229, 233, 449
FaqI GGGAC 1 cut(s) 588
FatI CATG 3 cut(s) 65, 231, 447
FspBI CTAG 1 cut(s) 357
HaeIII GGCC 1 cut(s) 361
Hin1II CATG 3 cut(s) 69, 235, 451
HinfI GANTC 1 cut(s) 352
HphI GGTGA 1 cut(s) 277
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 3 cut(s) 82, 187, 351
Hpy188III TCNNGA 1 cut(s) 204
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 490
HpyAV CCTTC 3 cut(s) 180, 458, 470
HpyCH4III ACNGT 1 cut(s) 532
HpyCH4V TGCA 2 cut(s) 179, 526
Hsp92II CATG 3 cut(s) 69, 235, 451
Kzo9I GATC 6 cut(s) 182, 289, 307, 346, 451, 482
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 1 cut(s) 324
LweI GCATC 1 cut(s) 513
MaeI CTAG 1 cut(s) 357
MaeIII GTNAC 2 cut(s) 61, 265
MalI GATC 6 cut(s) 184, 291, 309, 348, 453, 484
MboI GATC 6 cut(s) 182, 289, 307, 346, 451, 482
MboII GAAGA 6 cut(s) 56, 381, 396, 440, 482, 518
MflI RGATCY 1 cut(s) 346
MnlI CCTC 2 cut(s) 292, 473
MseI TTAA 4 cut(s) 146, 518, 534, 623
MslI CAYNNNNRTG 1 cut(s) 297
NdeII GATC 6 cut(s) 182, 289, 307, 346, 451, 482
NlaIII CATG 3 cut(s) 69, 235, 451
NlaIV GGNNCC 1 cut(s) 348
NmuCI GTSAC 1 cut(s) 265
NspI RCATGY 1 cut(s) 69
PciI ACATGT 1 cut(s) 65
PcsI WCGNNNNNNNCGW 1 cut(s) 451
PfeI GAWTC 1 cut(s) 352
PscI ACATGT 1 cut(s) 65
PshBI ATTAAT 2 cut(s) 146, 623
PspN4I GGNNCC 1 cut(s) 348
PspPI GGNCC 1 cut(s) 400
PsuI RGATCY 1 cut(s) 346
RseI CAYNNNNRTG 1 cut(s) 297
SaqAI TTAA 4 cut(s) 146, 518, 534, 623
Sau3AI GATC 6 cut(s) 182, 289, 307, 346, 451, 482
Sau96I GGNCC 1 cut(s) 400
SetI ASST 4 cut(s) 100, 425, 445, 514
SfaNI GCATC 1 cut(s) 513
SinI GGWCC 1 cut(s) 400
SmiMI CAYNNNNRTG 1 cut(s) 297
SspMI CTAG 1 cut(s) 357
StyI CCWWGG 1 cut(s) 356
TaaI ACNGT 1 cut(s) 532
TaqI TCGA 4 cut(s) 205, 315, 454, 485
TfiI GAWTC 1 cut(s) 352
Tru1I TTAA 4 cut(s) 146, 518, 534, 623
Tru9I TTAA 4 cut(s) 146, 518, 534, 623
TseFI GTSAC 1 cut(s) 265
Tsp45I GTSAC 1 cut(s) 265
TspDTI ATGAA 6 cut(s) 63, 86, 204, 248, 327, 489
VpaK11BI GGWCC 1 cut(s) 400
VspI ATTAAT 2 cut(s) 146, 623
XapI RAATTY 2 cut(s) 85, 215
XceI RCATGY 1 cut(s) 69
XmaJI CCTAGG 1 cut(s) 356
XspI CTAG 1 cut(s) 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.