Rmu_sc0000938.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000938.1
OG0000705
Physical Location & Seq
Reverse (-)
44799 .. 45284
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000938.1_g000012.1.cds

Sequence Viewer

Length: 486 bp
atgaaaggaaaatcattcaattgctacgatttgtgcaaagattgggtgacatttgacacaacctcacaagaacattttggtccaccccctgtgcaaagaaacctcccggtgtccttggaagatgatgataatcctgtcgatagtaattcaacaccaacttcatctaggaatctaattcctatgccgataggaagaaataccgcaagaagaaagcaaatcaaggaccaagaaaaagagaagaaagcctttgaagatcagttattagctcgcatggatcgattggcggaagataatgcgaaggcggaagaggcaaaagcaataagggagaagatgaaggaggatcgacgagagagagatagagaagaagctattttaatcatgcaaaccgttaattctgctccaaggagcaaggcttattttgatgggaaaaagacagaagcactagaaaagctaagcgcacgggaattgtatctgaataccggctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

18.54

Weight (kDa)

6.64

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 201, 284, 302
AclWI GGATC 2 cut(s) 282, 348
AgsI TTSAA 3 cut(s) 19, 150, 251
AluBI AGCT 3 cut(s) 266, 368, 451
AluI AGCT 3 cut(s) 266, 368, 451
AlwI GGATC 2 cut(s) 282, 348
AspLEI GCGC 1 cut(s) 458
AspS9I GGNCC 2 cut(s) 80, 223
AsuC2I CCSGG 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 58
AvaII GGWCC 2 cut(s) 80, 223
BccI CCATC 1 cut(s) 416
BcnI CCSGG 1 cut(s) 107
BfaI CTAG 2 cut(s) 165, 443
BlpI GCTNAGC 1 cut(s) 452
Bme1390I CCNGG 1 cut(s) 107
Bme18I GGWCC 2 cut(s) 80, 223
BmgT120I GGNCC 2 cut(s) 80, 223
BmrFI CCNGG 1 cut(s) 107
Bpu1102I GCTNAGC 1 cut(s) 452
BpuMI CCSGG 1 cut(s) 107
Bsa29I ATCGAT 1 cut(s) 277
BsaBI GATNNNNATC 1 cut(s) 129
BsaJI CCNNGG 2 cut(s) 114, 401
Bse118I RCCGGY 1 cut(s) 479
Bse8I GATNNNNATC 1 cut(s) 129
BseCI ATCGAT 1 cut(s) 277
BseDI CCNNGG 2 cut(s) 114, 401
BseJI GATNNNNATC 1 cut(s) 129
BshVI ATCGAT 1 cut(s) 277
BsiSI CCGG 2 cut(s) 107, 480
Bsp143I GATC 3 cut(s) 253, 274, 340
Bsp1720I GCTNAGC 1 cut(s) 452
BspACI CCGC 3 cut(s) 201, 284, 302
BspDI ATCGAT 1 cut(s) 277
BspPI GGATC 2 cut(s) 282, 348
BsrFI RCCGGY 1 cut(s) 479
BssAI RCCGGY 1 cut(s) 479
BssECI CCNNGG 2 cut(s) 114, 401
BssMI GATC 3 cut(s) 253, 274, 340
BssT1I CCWWGG 2 cut(s) 114, 401
Bst4CI ACNGT 1 cut(s) 388
Bst6I CTCTTC 1 cut(s) 300
BstC8I GCNNGC 1 cut(s) 268
BstDEI CTNAG 1 cut(s) 452
BstHHI GCGC 1 cut(s) 458
BstKTI GATC 3 cut(s) 256, 277, 343
BstMBI GATC 3 cut(s) 253, 274, 340
BstMWI GCNNNNNNNGC 1 cut(s) 308
BstSCI CCNGG 1 cut(s) 105
Bsu15I ATCGAT 1 cut(s) 277
BsuTUI ATCGAT 1 cut(s) 277
Cac8I GCNNGC 1 cut(s) 268
CfoI GCGC 1 cut(s) 458
Cfr10I RCCGGY 1 cut(s) 479
Cfr13I GGNCC 2 cut(s) 80, 223
ClaI ATCGAT 1 cut(s) 277
CviAII CATG 2 cut(s) 271, 379
CviJI RGCY 6 cut(s) 245, 266, 368, 413, 451, 483
CviKI_1 RGCY 6 cut(s) 245, 266, 368, 413, 451, 483
DdeI CTNAG 1 cut(s) 452
DpnI GATC 3 cut(s) 255, 276, 342
DpnII GATC 3 cut(s) 253, 274, 340
Eam1104I CTCTTC 1 cut(s) 300
EarI CTCTTC 1 cut(s) 300
EciI GGCGGA 2 cut(s) 299, 317
Eco130I CCWWGG 2 cut(s) 114, 401
Eco47I GGWCC 2 cut(s) 80, 223
EcoT14I CCWWGG 2 cut(s) 114, 401
ErhI CCWWGG 2 cut(s) 114, 401
FaeI CATG 2 cut(s) 274, 382
FaiI YATR 3 cut(s) 182, 272, 380
FalI AAGNNNNNCTT 2 cut(s) 230, 262
FatI CATG 2 cut(s) 270, 378
FspBI CTAG 2 cut(s) 165, 443
GlaI GCGC 1 cut(s) 457
HapII CCGG 2 cut(s) 107, 480
HhaI GCGC 1 cut(s) 458
Hin1II CATG 2 cut(s) 274, 382
Hin6I GCGC 1 cut(s) 456
HinP1I GCGC 1 cut(s) 456
HinfI GANTC 1 cut(s) 169
HpaII CCGG 2 cut(s) 107, 480
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 474
Hpy8I GTNNAC 1 cut(s) 83
Hpy99I CGWCG 1 cut(s) 348
HpyAV CCTTC 2 cut(s) 292, 328
HpyCH4III ACNGT 1 cut(s) 388
HpyCH4V TGCA 3 cut(s) 36, 94, 382
HpyF10VI GCNNNNNNNGC 1 cut(s) 308
HpyF3I CTNAG 1 cut(s) 452
Hsp92II CATG 2 cut(s) 274, 382
HspAI GCGC 1 cut(s) 456
Kzo9I GATC 3 cut(s) 253, 274, 340
LmnI GCTCC 2 cut(s) 403, 405
LpnPI CCDG 3 cut(s) 102, 120, 147
MaeI CTAG 2 cut(s) 165, 443
MaeIII GTNAC 1 cut(s) 46
MalI GATC 3 cut(s) 255, 276, 342
MboI GATC 3 cut(s) 253, 274, 340
MboII GAAGA 9 cut(s) 131, 204, 219, 250, 263, 299, 317, 340, 374
MfeI CAATTG 1 cut(s) 19
MluCI AATT 5 cut(s) 19, 145, 174, 391, 464
MnlI CCTC 4 cut(s) 73, 113, 301, 331
MseI TTAA 2 cut(s) 374, 390
MspI CCGG 2 cut(s) 107, 480
MspR9I CCNGG 1 cut(s) 107
MunI CAATTG 1 cut(s) 19
MwoI GCNNNNNNNGC 1 cut(s) 308
NciI CCSGG 1 cut(s) 107
NdeII GATC 3 cut(s) 253, 274, 340
NlaIII CATG 2 cut(s) 274, 382
NmuCI GTSAC 1 cut(s) 46
PcsI WCGNNNNNNNCGW 1 cut(s) 274
PfeI GAWTC 1 cut(s) 169
PspPI GGNCC 2 cut(s) 80, 223
SaqAI TTAA 2 cut(s) 374, 390
Sau3AI GATC 3 cut(s) 253, 274, 340
Sau96I GGNCC 2 cut(s) 80, 223
ScrFI CCNGG 1 cut(s) 107
SetI ASST 5 cut(s) 65, 105, 268, 370, 453
SinI GGWCC 2 cut(s) 80, 223
Sse9I AATT 5 cut(s) 19, 145, 174, 391, 464
SsiI CCGC 3 cut(s) 201, 284, 302
SspMI CTAG 2 cut(s) 165, 443
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 2 cut(s) 114, 401
TaaI ACNGT 1 cut(s) 388
TaqI TCGA 3 cut(s) 138, 277, 343
TasI AATT 5 cut(s) 19, 145, 174, 391, 464
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 2 cut(s) 374, 390
Tru9I TTAA 2 cut(s) 374, 390
TseFI GTSAC 1 cut(s) 46
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 3 cut(s) 17, 150, 347
VpaK11BI GGWCC 2 cut(s) 80, 223
XspI CTAG 2 cut(s) 165, 443
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.