Rmu_sc0005394.1_g000003

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005394.1
OG0000705
Physical Location & Seq
Reverse (-)
18777 .. 19952
1176 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005394.1_g000003.1.cds

Sequence Viewer

Length: 1056 bp
atgtccatcaaaggagcaaattggacaagaaaggaagatgaagctctttgcattgtgttcatccaagtatccgaaaactctgacaaaggtacgagccaaaaagagaccggcatttggaaacaagtggagcaaaagtttaaagaatttttcaatggtgctcctccgaatgttagaaattttgagagttgtaaatctcgatggcaaaaacacctcttcccacaaatgaacaaatggcatcaatgcgtcaaacgcgccgagaggaggattcatagcggagctaatcaatccgaccaacaacacttagccgaagatttctacaaggacgatatgaatggaaaaatttttcgccatcaaagttgttacaatttgtgtagcgatagttgggtgatgtttgatgatccaccactagaaaactttggtccatcaccggtgcaaagaaacctccctatttccttggaggatgatgaagagccaaatggatctacttcgacaccaacttcgactccagattcccttcctagaccaatgggacgaaatatggcaagaaaacataaattgttagaaaactttggtccatcaccggtgcaaagaaacctccctatttccttggaggatgatgaagagccaaatggatctacttcaacaccaacttcgactccagattcccttcctagaccaatgggacgaaatatggcaagaaaacataaattgaaggccaaagaaaaggaggagaaagcctttcaagaaaaattattggctaacatagagcaaatgagagaagaaaacatcaaagcggaagaggcaaaagccataagagagaaaatgaaggaggatcgacgagagagggacagggaagaagccattgtaatgatgcaaaccgttgattttactccaaggagcaaggcatattttgatgggaagaagagggaagctcttgaaaggctaagggcatgtgagttgtttcctaattccgccacaacatccaacgactaccatccacgtatggcaaccgaagacgactatcatccacgtatggcatccgaagatgacgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

351

Amino Acids

40.71

Weight (kDa)

6.08

Isoelectric Point (pI)

54.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 252
AciI CCGC 3 cut(s) 273, 794, 972
AclWI GGATC 4 cut(s) 392, 487, 640, 840
AcsI RAATTY 3 cut(s) 143, 175, 339
AfaI GTAC 1 cut(s) 91
AfiI CCNNNNNNNGG 2 cut(s) 114, 261
AgeI ACCGGT 2 cut(s) 427, 580
AgsI TTSAA 5 cut(s) 151, 642, 712, 743, 938
AluBI AGCT 3 cut(s) 44, 278, 932
AluI AGCT 3 cut(s) 44, 278, 932
Alw21I GWGCWC 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 4 cut(s) 392, 487, 640, 840
AoxI GGCC 1 cut(s) 714
ApoI RAATTY 3 cut(s) 143, 175, 339
ArsI GACNNNNNNTTYG 2 cut(s) 481, 513
AsiGI ACCGGT 2 cut(s) 427, 580
AspLEI GCGC 1 cut(s) 254
AspS9I GGNCC 2 cut(s) 419, 572
AsuHPI GGTGA 3 cut(s) 397, 417, 570
AvaII GGWCC 2 cut(s) 419, 572
BbsI GAAGAC 1 cut(s) 1020
Bbv12I GWGCWC 1 cut(s) 160
BccI CCATC 7 cut(s) 14, 192, 357, 430, 583, 908, 1002
BciVI GTATCC 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 3 cut(s) 407, 519, 672
BfuI GTATCC 1 cut(s) 79
Bme18I GGWCC 2 cut(s) 419, 572
BmgT120I GGNCC 2 cut(s) 419, 572
BmsI GCATC 3 cut(s) 244, 861, 1046
BpiI GAAGAC 1 cut(s) 1020
BplI GAGNNNNNCTC 2 cut(s) 916, 948
BpmI CTGGAG 2 cut(s) 489, 642
Bpu10I CCTNAGC 1 cut(s) 944
BsaAI YACGTR 2 cut(s) 1001, 1031
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 3 cut(s) 453, 606, 893
BsaWI WCCGGW 2 cut(s) 427, 580
BsaXI ACNNNNNCTCC 6 cut(s) 119, 149, 487, 517, 640, 670
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 261
Bse118I RCCGGY 3 cut(s) 107, 427, 580
BseDI CCNNGG 3 cut(s) 453, 606, 893
BseGI GGATG 7 cut(s) 60, 466, 619, 980, 994, 1024, 1037
BseLI CCNNNNNNNGG 2 cut(s) 114, 261
BseRI GAGGAG 3 cut(s) 150, 274, 743
Bsh1236I CGCG 1 cut(s) 252
BshFI GGCC 1 cut(s) 716
BshTI ACCGGT 2 cut(s) 427, 580
BsiHKAI GWGCWC 1 cut(s) 160
BsiSI CCGG 3 cut(s) 108, 428, 581
BslFI GGGAC 3 cut(s) 543, 696, 860
BslI CCNNNNNNNGG 2 cut(s) 114, 261
BsmAI GTCTC 1 cut(s) 98
BsmFI GGGAC 3 cut(s) 543, 696, 860
BsnI GGCC 1 cut(s) 716
Bso31I GGTCTC 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 4 cut(s) 397, 479, 632, 832
BspACI CCGC 3 cut(s) 273, 794, 972
BspANI GGCC 1 cut(s) 716
BspFNI CGCG 1 cut(s) 252
BspPI GGATC 4 cut(s) 392, 487, 640, 840
BspQI GCTCTTC 2 cut(s) 462, 615
BspTNI GGTCTC 1 cut(s) 98
BsrFI RCCGGY 3 cut(s) 107, 427, 580
BssAI RCCGGY 3 cut(s) 107, 427, 580
BssECI CCNNGG 3 cut(s) 453, 606, 893
BssMI GATC 4 cut(s) 397, 479, 632, 832
BssT1I CCWWGG 3 cut(s) 453, 606, 893
Bst4CI ACNGT 1 cut(s) 880
Bst6I CTCTTC 5 cut(s) 218, 462, 615, 792, 917
BstBAI YACGTR 2 cut(s) 1001, 1031
BstDEI CTNAG 2 cut(s) 301, 944
BstF5I GGATG 7 cut(s) 60, 466, 619, 980, 994, 1024, 1037
BstFNI CGCG 1 cut(s) 252
BstHHI GCGC 1 cut(s) 254
BstKTI GATC 4 cut(s) 400, 482, 635, 835
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 4 cut(s) 397, 479, 632, 832
BstMWI GCNNNNNNNGC 2 cut(s) 249, 800
BstNSI RCATGY 1 cut(s) 954
BstUI CGCG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 1020
BstX2I RGATCY 2 cut(s) 479, 632
BstYI RGATCY 2 cut(s) 479, 632
BsuI GTATCC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 716
BtsCI GGATG 7 cut(s) 60, 466, 619, 980, 994, 1024, 1037
CfoI GCGC 1 cut(s) 254
Cfr10I RCCGGY 3 cut(s) 107, 427, 580
Cfr13I GGNCC 2 cut(s) 419, 572
CseI GACGC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 90
CspAI ACCGGT 2 cut(s) 427, 580
CviAII CATG 1 cut(s) 951
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 2 cut(s) 301, 944
DpnI GATC 4 cut(s) 399, 481, 634, 834
DpnII GATC 4 cut(s) 397, 479, 632, 832
DraI TTTAAA 1 cut(s) 139
Eam1104I CTCTTC 5 cut(s) 218, 462, 615, 792, 917
EarI CTCTTC 5 cut(s) 218, 462, 615, 792, 917
EciI GGCGGA 1 cut(s) 961
Eco130I CCWWGG 3 cut(s) 453, 606, 893
Eco31I GGTCTC 1 cut(s) 98
Eco47I GGWCC 2 cut(s) 419, 572
EcoT14I CCWWGG 3 cut(s) 453, 606, 893
ErhI CCWWGG 3 cut(s) 453, 606, 893
FaeI CATG 1 cut(s) 954
FaqI GGGAC 3 cut(s) 543, 696, 860
FatI CATG 1 cut(s) 950
FokI GGATG 7 cut(s) 47, 473, 626, 967, 981, 1011, 1024
FspBI CTAG 3 cut(s) 407, 519, 672
GlaI GCGC 1 cut(s) 253
GsuI CTGGAG 2 cut(s) 489, 642
HaeIII GGCC 1 cut(s) 716
HapII CCGG 3 cut(s) 108, 428, 581
HgaI GACGC 1 cut(s) 232
HhaI GCGC 1 cut(s) 254
Hin1II CATG 1 cut(s) 954
Hin6I GCGC 1 cut(s) 252
HinP1I GCGC 1 cut(s) 252
HinfI GANTC 5 cut(s) 265, 502, 509, 655, 662
HpaII CCGG 3 cut(s) 108, 428, 581
HphI GGTGA 3 cut(s) 397, 417, 570
Hpy188I TCNGA 5 cut(s) 73, 82, 165, 289, 1042
Hpy188III TCNNGA 5 cut(s) 195, 506, 659, 743, 935
Hpy99I CGWCG 1 cut(s) 840
HpyAV CCTTC 4 cut(s) 524, 677, 706, 820
HpyCH4III ACNGT 1 cut(s) 880
HpyCH4IV ACGT 2 cut(s) 1000, 1030
HpyCH4V TGCA 4 cut(s) 51, 433, 586, 874
HpyF10VI GCNNNNNNNGC 2 cut(s) 249, 800
HpyF3I CTNAG 2 cut(s) 301, 944
HpySE526I ACGT 2 cut(s) 1000, 1030
Hsp92II CATG 1 cut(s) 954
HspAI GCGC 1 cut(s) 252
Kzo9I GATC 4 cut(s) 397, 479, 632, 832
LguI GCTCTTC 2 cut(s) 462, 615
LmnI GCTCC 5 cut(s) 14, 127, 163, 275, 897
LpnPI CCDG 6 cut(s) 121, 441, 519, 594, 672, 835
LweI GCATC 3 cut(s) 244, 861, 1046
MaeI CTAG 3 cut(s) 407, 519, 672
MaeII ACGT 2 cut(s) 1000, 1030
MaeIII GTNAC 1 cut(s) 359
MalI GATC 4 cut(s) 399, 481, 634, 834
MboI GATC 4 cut(s) 397, 479, 632, 832
MflI RGATCY 2 cut(s) 479, 632
MhlI GDGCHC 1 cut(s) 160
MluCI AATT 9 cut(s) 19, 143, 175, 339, 364, 554, 707, 749, 967
MlyI GAGTC 2 cut(s) 496, 649
MmeI TCCRAC 2 cut(s) 312, 1008
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 866
MspI CCGG 3 cut(s) 108, 428, 581
MvnI CGCG 1 cut(s) 252
MwoI GCNNNNNNNGC 2 cut(s) 249, 800
NdeII GATC 4 cut(s) 397, 479, 632, 832
NlaIII CATG 1 cut(s) 954
NmeAIII GCCGAG 1 cut(s) 280
NspI RCATGY 1 cut(s) 954
PciSI GCTCTTC 2 cut(s) 462, 615
PfeI GAWTC 3 cut(s) 265, 509, 662
PinAI ACCGGT 2 cut(s) 427, 580
PleI GAGTC 2 cut(s) 496, 649
PpsI GAGTC 2 cut(s) 496, 649
Ppu21I YACGTR 2 cut(s) 1001, 1031
PspPI GGNCC 2 cut(s) 419, 572
PsuI RGATCY 2 cut(s) 479, 632
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
RseI CAYNNNNRTG 1 cut(s) 866
SapI GCTCTTC 2 cut(s) 462, 615
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 4 cut(s) 397, 479, 632, 832
Sau96I GGNCC 2 cut(s) 419, 572
SchI GAGTC 2 cut(s) 496, 649
SduI GDGCHC 1 cut(s) 160
SetI ASST 9 cut(s) 46, 91, 213, 280, 444, 597, 934, 1003, 1033
SfaNI GCATC 3 cut(s) 244, 861, 1046
SgrAI CRCCGGYG 2 cut(s) 427, 580
SinI GGWCC 2 cut(s) 419, 572
SmiMI CAYNNNNRTG 1 cut(s) 866
Sse9I AATT 9 cut(s) 19, 143, 175, 339, 364, 554, 707, 749, 967
SsiI CCGC 3 cut(s) 273, 794, 972
SspMI CTAG 3 cut(s) 407, 519, 672
StyI CCWWGG 3 cut(s) 453, 606, 893
TaaI ACNGT 1 cut(s) 880
TaiI ACGT 2 cut(s) 1003, 1033
TaqI TCGA 5 cut(s) 196, 488, 500, 653, 835
TasI AATT 9 cut(s) 19, 143, 175, 339, 364, 554, 707, 749, 967
TfiI GAWTC 3 cut(s) 265, 509, 662
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 8 cut(s) 49, 54, 239, 257, 344, 480, 633, 839
VpaK11BI GGWCC 2 cut(s) 419, 572
XapI RAATTY 3 cut(s) 143, 175, 339
XceI RCATGY 1 cut(s) 954
XspI CTAG 3 cut(s) 407, 519, 672
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.