Rmu_sc0002539.1_g000108

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002539.1
OG0000705
Physical Location & Seq
Reverse (-)
434729 .. 434998
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002539.1_g000108.1.cds

Sequence Viewer

Length: 270 bp
atgattgctggaatgcgagaaagggaggcagaaatggcgaaagaggaaaggaagataagagacaagaaaagggaggaccaaagagaggttgctaggttagaggctattttaatgatgcaaaccattaattttactgtaaggagtaaagagtattttgatgggaagaaaagagatgctctccaccaattccaaggccgtgaattgtttccaaattccggagagacatccgatgtctattgtccacaaatgcctccggagtctttcctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.57

Weight (kDa)

6.6

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 2 cut(s) 215, 253
AcsI RAATTY 1 cut(s) 211
AfiI CCNNNNNNNGG 2 cut(s) 85, 215
Alw26I GTCTC 2 cut(s) 54, 215
Aor13HI TCCGGA 2 cut(s) 215, 253
AoxI GGCC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 211
AseI ATTAAT 1 cut(s) 126
Asp700I GAANNNNTTC 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 76
AvaII GGWCC 1 cut(s) 76
BccI CCATC 1 cut(s) 152
BceAI ACGGC 1 cut(s) 180
BcoDI GTCTC 2 cut(s) 54, 215
BfaI CTAG 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 266
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 76
BmsI GCATC 2 cut(s) 105, 163
BplI GAGNNNNNCTC 2 cut(s) 162, 194
BsaJI CCNNGG 1 cut(s) 190
BsaWI WCCGGW 2 cut(s) 215, 253
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 215
BseAI TCCGGA 2 cut(s) 215, 253
BseDI CCNNGG 1 cut(s) 190
BseGI GGATG 1 cut(s) 224
BseLI CCNNNNNNNGG 2 cut(s) 85, 215
BshFI GGCC 1 cut(s) 195
BsiSI CCGG 2 cut(s) 216, 254
BslI CCNNNNNNNGG 2 cut(s) 85, 215
BsmAI GTCTC 2 cut(s) 54, 215
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 1 cut(s) 195
Bsp13I TCCGGA 2 cut(s) 215, 253
BspANI GGCC 1 cut(s) 195
BspEI TCCGGA 2 cut(s) 215, 253
BssECI CCNNGG 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 136
BstF5I GGATG 1 cut(s) 224
BstMAI GTCTC 2 cut(s) 54, 215
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstSFI CTRYAG 1 cut(s) 266
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 1 cut(s) 224
Cfr13I GGNCC 1 cut(s) 76
CviJI RGCY 2 cut(s) 104, 195
CviKI_1 RGCY 2 cut(s) 104, 195
Eco130I CCWWGG 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 190
ErhI CCWWGG 1 cut(s) 190
FaiI YATR 1 cut(s) 268
FokI GGATG 1 cut(s) 211
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 1 cut(s) 195
HapII CCGG 2 cut(s) 216, 254
HinfI GANTC 1 cut(s) 257
HpaII CCGG 2 cut(s) 216, 254
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 216, 254
Hpy8I GTNNAC 1 cut(s) 242
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4V TGCA 1 cut(s) 118
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Kpn2I TCCGGA 2 cut(s) 215, 253
LpnPI CCDG 1 cut(s) 229
LweI GCATC 2 cut(s) 105, 163
MaeI CTAG 1 cut(s) 93
MboII GAAGA 2 cut(s) 64, 175
MluCI AATT 4 cut(s) 127, 185, 200, 211
MlyI GAGTC 1 cut(s) 266
MnlI CCTC 6 cut(s) 19, 37, 67, 79, 94, 261
MroI TCCGGA 2 cut(s) 215, 253
MroXI GAANNNNTTC 1 cut(s) 204
MseI TTAA 2 cut(s) 110, 126
MspI CCGG 2 cut(s) 216, 254
Mva1269I GAATGC 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 35
PctI GAATGC 1 cut(s) 18
PdmI GAANNNNTTC 1 cut(s) 204
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
PshBI ATTAAT 1 cut(s) 126
PspPI GGNCC 1 cut(s) 76
SaqAI TTAA 2 cut(s) 110, 126
Sau96I GGNCC 1 cut(s) 76
SchI GAGTC 1 cut(s) 266
SetI ASST 2 cut(s) 90, 98
SfaNI GCATC 2 cut(s) 105, 163
SfcI CTRYAG 1 cut(s) 266
SgeI CNNG 8 cut(s) 21, 29, 76, 105, 203, 209, 228, 266
SinI GGWCC 1 cut(s) 76
Sse9I AATT 4 cut(s) 127, 185, 200, 211
SspMI CTAG 1 cut(s) 93
StyI CCWWGG 1 cut(s) 190
TaaI ACNGT 1 cut(s) 136
TasI AATT 4 cut(s) 127, 185, 200, 211
Tru1I TTAA 2 cut(s) 110, 126
Tru9I TTAA 2 cut(s) 110, 126
VpaK11BI GGWCC 1 cut(s) 76
VspI ATTAAT 1 cut(s) 126
XapI RAATTY 1 cut(s) 211
XmnI GAANNNNTTC 1 cut(s) 204
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.