Rmu_sc0013665.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013665.1
OG0000705
Physical Location & Seq
Forward (+)
1 .. 764
764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013665.1_g000001.1.cds

Sequence Viewer

Length: 441 bp
gttcaacgaaacacctcaatttctttggaggaggatgtggatcccattgaggattctcctacttcatctcaaacgcaaattcctaggcctatgggaagaaatgccgcaagaaatacaaggaaaaagggcaaagaggcggaagtcaaagccattggagaagatatggttgccggaataagagaaatggctgcacaaatgaaagaggcggaagaggaaaggaagagaagagagaagaaaagggaggatcgaagagaggttgctaggttagaggctattttaatgatgcaaaccattgattttactccaaggagtaaagagtattttgatgggaagaaaagagaagctctccacaaactaagaggacgtgaattgtttccaaattccggcgagacatccgatgtctatcgtccacaaatgccatccgatgaagatgaagcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

16.86

Weight (kDa)

6.07

Isoelectric Point (pI)

56.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 105, 137, 206
AclWI GGATC 3 cut(s) 35, 48, 252
AcsI RAATTY 2 cut(s) 78, 379
AfiI CCNNNNNNNGG 1 cut(s) 383
AgsI TTSAA 1 cut(s) 5
AjiI CACGTC 1 cut(s) 365
AluBI AGCT 2 cut(s) 344, 437
AluI AGCT 2 cut(s) 344, 437
Alw26I GTCTC 1 cut(s) 383
AlwI GGATC 3 cut(s) 35, 48, 252
AoxI GGCC 1 cut(s) 86
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 78, 379
Asp700I GAANNNNTTC 1 cut(s) 372
AspA2I CCTAGG 1 cut(s) 83
AvrII CCTAGG 1 cut(s) 83
BamHI GGATCC 1 cut(s) 40
BbvI GCAGC 1 cut(s) 175
BccI CCATC 2 cut(s) 320, 427
BcoDI GTCTC 1 cut(s) 383
BfaI CTAG 2 cut(s) 84, 261
BisI GCNGC 2 cut(s) 105, 189
BlnI CCTAGG 1 cut(s) 83
BlsI GCNGC 2 cut(s) 106, 190
BmgBI CACGTC 1 cut(s) 365
BmiI GGNNCC 1 cut(s) 42
BmsI GCATC 1 cut(s) 273
BplI GAGNNNNNCTC 2 cut(s) 330, 362
BsaBI GATNNNNATC 2 cut(s) 39, 402
BsaJI CCNNGG 2 cut(s) 83, 305
Bsc4I CCNNNNNNNGG 1 cut(s) 383
Bse8I GATNNNNATC 2 cut(s) 39, 402
BseDI CCNNGG 2 cut(s) 83, 305
BseGI GGATG 3 cut(s) 40, 392, 419
BseJI GATNNNNATC 2 cut(s) 39, 402
BseLI CCNNNNNNNGG 1 cut(s) 383
BseRI GAGGAG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 175
BsgI GTGCAG 1 cut(s) 174
BshFI GGCC 1 cut(s) 88
BsiSI CCGG 2 cut(s) 171, 384
BslI CCNNNNNNNGG 1 cut(s) 383
BsmAI GTCTC 1 cut(s) 383
BsnI GGCC 1 cut(s) 88
Bsp143I GATC 2 cut(s) 40, 244
BspACI CCGC 3 cut(s) 105, 137, 206
BspANI GGCC 1 cut(s) 88
BspLI GGNNCC 1 cut(s) 42
BspPI GGATC 3 cut(s) 35, 48, 252
BssECI CCNNGG 2 cut(s) 83, 305
BssMI GATC 2 cut(s) 40, 244
BssT1I CCWWGG 2 cut(s) 83, 305
Bst6I CTCTTC 4 cut(s) 204, 215, 220, 244
BstDEI CTNAG 1 cut(s) 356
BstF5I GGATG 3 cut(s) 40, 392, 419
BstKTI GATC 2 cut(s) 43, 247
BstMAI GTCTC 1 cut(s) 383
BstMBI GATC 2 cut(s) 40, 244
BstV1I GCAGC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BsuRI GGCC 1 cut(s) 88
BtrI CACGTC 1 cut(s) 365
BtsCI GGATG 3 cut(s) 40, 392, 419
CviJI RGCY 6 cut(s) 88, 149, 188, 272, 344, 437
CviKI_1 RGCY 6 cut(s) 88, 149, 188, 272, 344, 437
DdeI CTNAG 1 cut(s) 356
DpnI GATC 2 cut(s) 42, 246
DpnII GATC 2 cut(s) 40, 244
Eam1104I CTCTTC 4 cut(s) 204, 215, 220, 244
EarI CTCTTC 4 cut(s) 204, 215, 220, 244
EciI GGCGGA 2 cut(s) 152, 221
Eco130I CCWWGG 2 cut(s) 83, 305
Eco147I AGGCCT 1 cut(s) 88
EcoT14I CCWWGG 2 cut(s) 83, 305
ErhI CCWWGG 2 cut(s) 83, 305
FaiI YATR 2 cut(s) 92, 164
Fnu4HI GCNGC 2 cut(s) 105, 189
FokI GGATG 3 cut(s) 47, 379, 406
Fsp4HI GCNGC 2 cut(s) 105, 189
FspBI CTAG 2 cut(s) 84, 261
GluI GCNGC 2 cut(s) 105, 189
HaeIII GGCC 1 cut(s) 88
HapII CCGG 2 cut(s) 171, 384
HindIII AAGCTT 1 cut(s) 435
HinfI GANTC 1 cut(s) 53
HpaII CCGG 2 cut(s) 171, 384
Hpy166II GTNNAC 1 cut(s) 410
Hpy188I TCNGA 2 cut(s) 397, 424
Hpy8I GTNNAC 1 cut(s) 410
HpyCH4IV ACGT 1 cut(s) 364
HpyCH4V TGCA 2 cut(s) 191, 286
HpyF3I CTNAG 1 cut(s) 356
HpySE526I ACGT 1 cut(s) 364
Kzo9I GATC 2 cut(s) 40, 244
LpnPI CCDG 2 cut(s) 184, 397
Lsp1109I GCAGC 1 cut(s) 175
LweI GCATC 1 cut(s) 273
MaeI CTAG 2 cut(s) 84, 261
MaeII ACGT 1 cut(s) 364
MalI GATC 2 cut(s) 42, 246
MboI GATC 2 cut(s) 40, 244
MboII GAAGA 9 cut(s) 108, 170, 221, 232, 237, 244, 261, 343, 440
MflI RGATCY 1 cut(s) 40
MluCI AATT 4 cut(s) 18, 78, 368, 379
MroXI GAANNNNTTC 1 cut(s) 372
MseI TTAA 2 cut(s) 278, 439
MspI CCGG 2 cut(s) 171, 384
NdeII GATC 2 cut(s) 40, 244
NlaIV GGNNCC 1 cut(s) 42
PceI AGGCCT 1 cut(s) 88
PdmI GAANNNNTTC 1 cut(s) 372
PfeI GAWTC 1 cut(s) 53
PkrI GCNGC 2 cut(s) 106, 190
PspN4I GGNNCC 1 cut(s) 42
PsuI RGATCY 1 cut(s) 40
SaqAI TTAA 2 cut(s) 278, 439
SatI GCNGC 2 cut(s) 105, 189
Sau3AI GATC 2 cut(s) 40, 244
SetI ASST 6 cut(s) 17, 258, 266, 346, 367, 439
SfaNI GCATC 1 cut(s) 273
SgeI CNNG 9 cut(s) 96, 120, 129, 183, 273, 318, 377, 396, 400
Sse9I AATT 4 cut(s) 18, 78, 368, 379
SseBI AGGCCT 1 cut(s) 88
SsiI CCGC 3 cut(s) 105, 137, 206
SspMI CTAG 2 cut(s) 84, 261
StuI AGGCCT 1 cut(s) 88
StyI CCWWGG 2 cut(s) 83, 305
TaiI ACGT 1 cut(s) 367
TaqI TCGA 1 cut(s) 247
TasI AATT 4 cut(s) 18, 78, 368, 379
TauI GCSGC 1 cut(s) 107
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 2 cut(s) 278, 439
Tru9I TTAA 2 cut(s) 278, 439
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 3 cut(s) 54, 212, 441
XapI RAATTY 2 cut(s) 78, 379
XmaJI CCTAGG 1 cut(s) 83
XmnI GAANNNNTTC 1 cut(s) 372
XspI CTAG 2 cut(s) 84, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.