Rmu_sc0008518.1_g000027

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008518.1
OG0000705
Physical Location & Seq
Reverse (-)
112280 .. 114494
2215 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008518.1_g000027.1.cds

Sequence Viewer

Length: 579 bp
atgtattaccagttagttgagcataagctgaagattggtgagagcaccatggcccatcggtctaggagatgcgtcaatgagccgacgaggttactgaacgaaattaccatgcatgccacaaactttgacagacaattagggtttagggcctttagggacgactacggaggacaaccatttaagtatggtaattgttataatttgtgcaaagattgggtgacgtttcaagatccacctcaagaacaatttggtccaacaccgattcaacaaaacacctcaatttctttggaggaggatgatgatcccattgaggattctcctacttcatctcaaacgcgaattcctaggcctatgggaagaaatgccgcaagaaaaacgagacaaaagggcaaagaggcggaagtcaaagccattggaggagaaatggttgtcggaatgagagaaatggtggcacaaatgaaagaggtggaagaggaaaggaagagaagagagaagaaaagggaggatcgaagagaggttgctaggttagaggctattttaatgatgcaaaccatcaattttactccaaggagtaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

192

Amino Acids

22.46

Weight (kDa)

8.97

Isoelectric Point (pI)

54.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 198
AccII CGCG 1 cut(s) 337
AciI CCGC 2 cut(s) 366, 398
AclWI GGATC 3 cut(s) 224, 296, 513
AcsI RAATTY 1 cut(s) 339
AcuI CTGAAG 1 cut(s) 50
AgsI TTSAA 2 cut(s) 227, 266
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
Alw21I GWGCWC 1 cut(s) 47
Alw26I GTCTC 1 cut(s) 373
AlwI GGATC 3 cut(s) 224, 296, 513
AoxI GGCC 3 cut(s) 51, 147, 347
ApoI RAATTY 1 cut(s) 339
AspA2I CCTAGG 1 cut(s) 344
AspS9I GGNCC 3 cut(s) 52, 147, 251
AsuHPI GGTGA 2 cut(s) 50, 229
AvaII GGWCC 1 cut(s) 251
AvrII CCTAGG 1 cut(s) 344
Bbv12I GWGCWC 1 cut(s) 47
BccI CCATC 2 cut(s) 63, 560
BcoDI GTCTC 1 cut(s) 373
BfaI CTAG 3 cut(s) 63, 345, 522
BisI GCNGC 1 cut(s) 366
BlnI CCTAGG 1 cut(s) 344
BlsI GCNGC 1 cut(s) 367
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 3 cut(s) 52, 147, 251
BmsI GCATC 2 cut(s) 59, 534
BpuEI CTTGAG 1 cut(s) 222
BsaBI GATNNNNATC 1 cut(s) 300
BsaJI CCNNGG 3 cut(s) 48, 344, 566
BsaXI ACNNNNNCTCC 2 cut(s) 411, 441
Bse1I ACTGG 1 cut(s) 10
Bse8I GATNNNNATC 1 cut(s) 300
BseDI CCNNGG 3 cut(s) 48, 344, 566
BseGI GGATG 1 cut(s) 301
BseJI GATNNNNATC 1 cut(s) 300
BseNI ACTGG 1 cut(s) 10
BseRI GAGGAG 2 cut(s) 305, 432
Bsh1236I CGCG 1 cut(s) 337
BshFI GGCC 3 cut(s) 53, 149, 349
BsiHKAI GWGCWC 1 cut(s) 47
BslFI GGGAC 1 cut(s) 170
BsmAI GTCTC 1 cut(s) 373
BsmFI GGGAC 1 cut(s) 170
BsnI GGCC 3 cut(s) 53, 149, 349
Bsp1286I GDGCHC 1 cut(s) 47
Bsp143I GATC 3 cut(s) 229, 301, 505
Bsp19I CCATGG 1 cut(s) 48
BspACI CCGC 2 cut(s) 366, 398
BspANI GGCC 3 cut(s) 53, 149, 349
BspFNI CGCG 1 cut(s) 337
BspPI GGATC 3 cut(s) 224, 296, 513
BsrI ACTGG 1 cut(s) 10
BssECI CCNNGG 3 cut(s) 48, 344, 566
BssMI GATC 3 cut(s) 229, 301, 505
BssT1I CCWWGG 3 cut(s) 48, 344, 566
Bst6I CTCTTC 4 cut(s) 465, 476, 481, 505
BstC8I GCNNGC 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 48
BstF5I GGATG 1 cut(s) 301
BstFNI CGCG 1 cut(s) 337
BstKTI GATC 3 cut(s) 232, 304, 508
BstMAI GTCTC 1 cut(s) 373
BstMBI GATC 3 cut(s) 229, 301, 505
BstNSI RCATGY 1 cut(s) 116
BstUI CGCG 1 cut(s) 337
BstX2I RGATCY 1 cut(s) 229
BstYI RGATCY 1 cut(s) 229
BsuRI GGCC 3 cut(s) 53, 149, 349
BtgI CCRYGG 1 cut(s) 48
BtsCI GGATG 1 cut(s) 301
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 3 cut(s) 52, 147, 251
CseI GACGC 1 cut(s) 61
CspCI CAANNNNNGTGG 2 cut(s) 106, 141
CviAII CATG 3 cut(s) 49, 109, 113
CviJI RGCY 7 cut(s) 28, 53, 82, 149, 349, 410, 533
CviKI_1 RGCY 7 cut(s) 28, 53, 82, 149, 349, 410, 533
DpnI GATC 3 cut(s) 231, 303, 507
DpnII GATC 3 cut(s) 229, 301, 505
Eam1104I CTCTTC 4 cut(s) 465, 476, 481, 505
EarI CTCTTC 4 cut(s) 465, 476, 481, 505
EciI GGCGGA 1 cut(s) 413
Eco130I CCWWGG 3 cut(s) 48, 344, 566
Eco147I AGGCCT 1 cut(s) 349
Eco47I GGWCC 1 cut(s) 251
Eco57I CTGAAG 1 cut(s) 50
EcoO109I RGGNCCY 1 cut(s) 147
EcoRI GAATTC 1 cut(s) 339
EcoT14I CCWWGG 3 cut(s) 48, 344, 566
EcoT22I ATGCAT 1 cut(s) 114
ErhI CCWWGG 3 cut(s) 48, 344, 566
FaeI CATG 3 cut(s) 52, 112, 116
FaiI YATR 7 cut(s) 24, 50, 110, 114, 186, 198, 353
FaqI GGGAC 1 cut(s) 170
FatI CATG 3 cut(s) 48, 108, 112
Fnu4HI GCNGC 1 cut(s) 366
FokI GGATG 1 cut(s) 308
Fsp4HI GCNGC 1 cut(s) 366
FspBI CTAG 3 cut(s) 63, 345, 522
GluI GCNGC 1 cut(s) 366
HaeIII GGCC 3 cut(s) 53, 149, 349
HgaI GACGC 1 cut(s) 61
Hin1II CATG 3 cut(s) 52, 112, 116
HinfI GANTC 2 cut(s) 262, 314
HphI GGTGA 2 cut(s) 50, 229
Hpy188I TCNGA 1 cut(s) 434
Hpy188III TCNNGA 2 cut(s) 227, 239
Hpy99I CGWCG 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 221
HpyCH4V TGCA 3 cut(s) 112, 207, 547
HpySE526I ACGT 1 cut(s) 221
Hsp92II CATG 3 cut(s) 52, 112, 116
Kzo9I GATC 3 cut(s) 229, 301, 505
LpnPI CCDG 1 cut(s) 23
LweI GCATC 2 cut(s) 59, 534
MaeI CTAG 3 cut(s) 63, 345, 522
MaeII ACGT 1 cut(s) 221
MaeIII GTNAC 2 cut(s) 90, 217
MalI GATC 3 cut(s) 231, 303, 507
MboI GATC 3 cut(s) 229, 301, 505
MboII GAAGA 7 cut(s) 43, 369, 482, 493, 498, 505, 522
MflI RGATCY 1 cut(s) 229
MhlI GDGCHC 1 cut(s) 47
MluCI AATT 8 cut(s) 102, 134, 190, 199, 245, 279, 339, 556
MmeI TCCRAC 2 cut(s) 278, 412
Mph1103I ATGCAT 1 cut(s) 114
MseI TTAA 2 cut(s) 180, 539
MvnI CGCG 1 cut(s) 337
NcoI CCATGG 1 cut(s) 48
NdeII GATC 3 cut(s) 229, 301, 505
NlaIII CATG 3 cut(s) 52, 112, 116
NmuCI GTSAC 1 cut(s) 217
NsiI ATGCAT 1 cut(s) 114
NspI RCATGY 1 cut(s) 116
PaeI GCATGC 1 cut(s) 116
PceI AGGCCT 1 cut(s) 349
PfeI GAWTC 2 cut(s) 262, 314
PkrI GCNGC 1 cut(s) 367
PsiI TTATAA 1 cut(s) 198
PspPI GGNCC 3 cut(s) 52, 147, 251
PsuI RGATCY 1 cut(s) 229
SaqAI TTAA 2 cut(s) 180, 539
SatI GCNGC 1 cut(s) 366
Sau3AI GATC 3 cut(s) 229, 301, 505
Sau96I GGNCC 3 cut(s) 52, 147, 251
SduI GDGCHC 1 cut(s) 47
SetI ASST 8 cut(s) 30, 92, 224, 238, 278, 468, 519, 527
SfaNI GCATC 2 cut(s) 59, 534
SinI GGWCC 1 cut(s) 251
SmlI CTYRAG 1 cut(s) 237
SmoI CTYRAG 1 cut(s) 237
SphI GCATGC 1 cut(s) 116
Sse9I AATT 8 cut(s) 102, 134, 190, 199, 245, 279, 339, 556
SseBI AGGCCT 1 cut(s) 349
SsiI CCGC 2 cut(s) 366, 398
SspMI CTAG 3 cut(s) 63, 345, 522
StuI AGGCCT 1 cut(s) 349
StyI CCWWGG 3 cut(s) 48, 344, 566
TaiI ACGT 1 cut(s) 224
TaqI TCGA 1 cut(s) 508
TaqII GACCGA 1 cut(s) 48
TasI AATT 8 cut(s) 102, 134, 190, 199, 245, 279, 339, 556
TauI GCSGC 1 cut(s) 368
TfiI GAWTC 2 cut(s) 262, 314
Tru1I TTAA 2 cut(s) 180, 539
Tru9I TTAA 2 cut(s) 180, 539
TseFI GTSAC 1 cut(s) 217
Tsp45I GTSAC 1 cut(s) 217
TspDTI ATGAA 2 cut(s) 315, 473
TspGWI ACGGA 1 cut(s) 180
VpaK11BI GGWCC 1 cut(s) 251
XapI RAATTY 1 cut(s) 339
XceI RCATGY 1 cut(s) 116
XmaJI CCTAGG 1 cut(s) 344
XspI CTAG 3 cut(s) 63, 345, 522
Zsp2I ATGCAT 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.