Rw4G032310

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0000705
Physical Location & Seq
Reverse (-)
59456794 .. 59457709
916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G032310.1

Sequence Viewer

Length: 789 bp
ATGTCCACTCCTTCTCTCAAAGGTGTGAATTGGACAAGAAAAGAAGATGAAGCTCTTTTTGTTGCATATATGAAAGGAGACAGCATTTGGAAACAAGTGGAGCGAAAATTAATTGGTGGCTTCAATGGCAATCCTCCAAATGCAAGATCGGATGAAAATTGTAAATCTCGATGGAAAAAATTTCTCTTTCCATACATGAATAAGTGGGATTCTTACGTCACACGTTCCGAGAGAAGACTTCATAGTGGAGCAAATCACATTGATCTAATAAGATTCCTATCATATATATTTTTTATGTATTACATGAAAGGAAAATCATTCAATTGCTACGATTTGTGCAAAGATTGGGTGACATTTGACACAACCTCACAAGAACATTTTGGTCCACCCCCTGTGCAAAGAAACCTCCCGGTGTCCTTGGAAGATGATGATAATCCTGTCGATAGTAATTCAACACCAACTTCATCTAGGAATCTAATTCCTGTGCCGATAGGAAGAAATACCGCAAGAAGAAAGCAAATCAAGGACCAAGAAAAAGAGAAGAAAGCCTTTGAAGATCAGTTATTAGCTCGCATGGATCGATTGGCGGAAGATAATGCGAAGGCGGAAGAGGCAAAAGCAATAAGGGAGAAGATGAAGGAGGATCGACGAGAGAGAGATAGAGAAGAAGCTATTTTAATCATGCAAACCGTTAATTCTGCTCCAAGGAGCAAGGCTTATTTTGATGGGAAAAAGACAGAAGCACTAGAAAAGCTAAGCGCACGGGAATTGTATCTGAATACCGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

262

Amino Acids

30.57

Weight (kDa)

9.15

Isoelectric Point (pI)

54.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 504, 587, 605
AclWI GGATC 2 cut(s) 585, 651
AcsI RAATTY 1 cut(s) 179
AflIII ACRYGT 1 cut(s) 221
AgsI TTSAA 4 cut(s) 124, 322, 453, 554
AluBI AGCT 4 cut(s) 53, 569, 671, 754
AluI AGCT 4 cut(s) 53, 569, 671, 754
Alw26I GTCTC 1 cut(s) 72
AlwI GGATC 2 cut(s) 585, 651
ApoI RAATTY 1 cut(s) 179
AseI ATTAAT 1 cut(s) 110
AspLEI GCGC 1 cut(s) 761
AspS9I GGNCC 2 cut(s) 383, 526
AsuC2I CCSGG 1 cut(s) 410
AsuHPI GGTGA 1 cut(s) 361
AvaII GGWCC 2 cut(s) 383, 526
BbsI GAAGAC 1 cut(s) 241
BccI CCATC 2 cut(s) 165, 719
BcnI CCSGG 1 cut(s) 410
BcoDI GTCTC 1 cut(s) 72
BfaI CTAG 2 cut(s) 468, 746
BlpI GCTNAGC 1 cut(s) 755
Bme1390I CCNGG 1 cut(s) 410
Bme18I GGWCC 2 cut(s) 383, 526
BmgT120I GGNCC 2 cut(s) 383, 526
BmrFI CCNGG 1 cut(s) 410
BpiI GAAGAC 1 cut(s) 241
Bpu1102I GCTNAGC 1 cut(s) 755
BpuMI CCSGG 1 cut(s) 410
Bsa29I ATCGAT 1 cut(s) 580
BsaBI GATNNNNATC 2 cut(s) 277, 432
BsaJI CCNNGG 2 cut(s) 417, 704
Bse118I RCCGGY 1 cut(s) 782
Bse8I GATNNNNATC 2 cut(s) 277, 432
BseCI ATCGAT 1 cut(s) 580
BseDI CCNNGG 2 cut(s) 417, 704
BseGI GGATG 1 cut(s) 157
BseJI GATNNNNATC 2 cut(s) 277, 432
BshVI ATCGAT 1 cut(s) 580
BsiSI CCGG 2 cut(s) 410, 783
BsmAI GTCTC 1 cut(s) 72
Bsp143I GATC 5 cut(s) 146, 262, 556, 577, 643
Bsp1720I GCTNAGC 1 cut(s) 755
BspACI CCGC 3 cut(s) 504, 587, 605
BspDI ATCGAT 1 cut(s) 580
BspPI GGATC 2 cut(s) 585, 651
BsrFI RCCGGY 1 cut(s) 782
BssAI RCCGGY 1 cut(s) 782
BssECI CCNNGG 2 cut(s) 417, 704
BssMI GATC 5 cut(s) 146, 262, 556, 577, 643
BssT1I CCWWGG 2 cut(s) 417, 704
Bst4CI ACNGT 1 cut(s) 691
Bst6I CTCTTC 1 cut(s) 603
BstC8I GCNNGC 1 cut(s) 571
BstDEI CTNAG 1 cut(s) 755
BstF5I GGATG 1 cut(s) 157
BstHHI GCGC 1 cut(s) 761
BstKTI GATC 5 cut(s) 149, 265, 559, 580, 646
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 5 cut(s) 146, 262, 556, 577, 643
BstMWI GCNNNNNNNGC 2 cut(s) 126, 611
BstSCI CCNGG 1 cut(s) 408
BstV2I GAAGAC 1 cut(s) 241
Bsu15I ATCGAT 1 cut(s) 580
BsuTUI ATCGAT 1 cut(s) 580
BtsCI GGATG 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 571
CfoI GCGC 1 cut(s) 761
Cfr10I RCCGGY 1 cut(s) 782
Cfr13I GGNCC 2 cut(s) 383, 526
ClaI ATCGAT 1 cut(s) 580
CviAII CATG 4 cut(s) 196, 304, 574, 682
CviJI RGCY 8 cut(s) 53, 120, 548, 569, 671, 716, 754, 786
CviKI_1 RGCY 8 cut(s) 53, 120, 548, 569, 671, 716, 754, 786
DdeI CTNAG 1 cut(s) 755
DpnI GATC 5 cut(s) 148, 264, 558, 579, 645
DpnII GATC 5 cut(s) 146, 262, 556, 577, 643
Eam1104I CTCTTC 1 cut(s) 603
EarI CTCTTC 1 cut(s) 603
EciI GGCGGA 2 cut(s) 602, 620
Eco130I CCWWGG 2 cut(s) 417, 704
Eco47I GGWCC 2 cut(s) 383, 526
EcoT14I CCWWGG 2 cut(s) 417, 704
ErhI CCWWGG 2 cut(s) 417, 704
FaeI CATG 4 cut(s) 199, 307, 577, 685
FalI AAGNNNNNCTT 2 cut(s) 533, 565
FatI CATG 4 cut(s) 195, 303, 573, 681
FokI GGATG 1 cut(s) 164
FspBI CTAG 2 cut(s) 468, 746
GlaI GCGC 1 cut(s) 760
HapII CCGG 2 cut(s) 410, 783
HhaI GCGC 1 cut(s) 761
Hin1II CATG 4 cut(s) 199, 307, 577, 685
Hin6I GCGC 1 cut(s) 759
HinP1I GCGC 1 cut(s) 759
HinfI GANTC 3 cut(s) 209, 273, 472
HpaII CCGG 2 cut(s) 410, 783
HphI GGTGA 1 cut(s) 361
Hpy166II GTNNAC 2 cut(s) 6, 386
Hpy188I TCNGA 3 cut(s) 151, 229, 777
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 2 cut(s) 6, 386
Hpy99I CGWCG 1 cut(s) 651
HpyAV CCTTC 3 cut(s) 21, 595, 631
HpyCH4III ACNGT 1 cut(s) 691
HpyCH4IV ACGT 2 cut(s) 216, 223
HpyCH4V TGCA 5 cut(s) 65, 143, 339, 397, 685
HpyF10VI GCNNNNNNNGC 2 cut(s) 126, 611
HpyF3I CTNAG 1 cut(s) 755
HpySE526I ACGT 2 cut(s) 216, 223
Hsp92II CATG 4 cut(s) 199, 307, 577, 685
HspAI GCGC 1 cut(s) 759
Kzo9I GATC 5 cut(s) 146, 262, 556, 577, 643
LmnI GCTCC 4 cut(s) 100, 248, 706, 708
LpnPI CCDG 4 cut(s) 405, 423, 450, 495
MaeI CTAG 2 cut(s) 468, 746
MaeII ACGT 2 cut(s) 216, 223
MaeIII GTNAC 2 cut(s) 217, 349
MalI GATC 5 cut(s) 148, 264, 558, 579, 645
MboI GATC 5 cut(s) 146, 262, 556, 577, 643
MfeI CAATTG 1 cut(s) 322
MnlI CCTC 5 cut(s) 144, 376, 416, 604, 634
MseI TTAA 3 cut(s) 110, 677, 693
MspI CCGG 2 cut(s) 410, 783
MspR9I CCNGG 1 cut(s) 410
MunI CAATTG 1 cut(s) 322
MwoI GCNNNNNNNGC 2 cut(s) 126, 611
NciI CCSGG 1 cut(s) 410
NdeII GATC 5 cut(s) 146, 262, 556, 577, 643
NlaIII CATG 4 cut(s) 199, 307, 577, 685
NmuCI GTSAC 2 cut(s) 217, 349
PcsI WCGNNNNNNNCGW 1 cut(s) 577
PfeI GAWTC 3 cut(s) 209, 273, 472
PshBI ATTAAT 1 cut(s) 110
PspPI GGNCC 2 cut(s) 383, 526
SaqAI TTAA 3 cut(s) 110, 677, 693
Sau3AI GATC 5 cut(s) 146, 262, 556, 577, 643
Sau96I GGNCC 2 cut(s) 383, 526
ScrFI CCNGG 1 cut(s) 410
SetI ASST 9 cut(s) 25, 55, 219, 226, 368, 408, 571, 673, 756
SinI GGWCC 2 cut(s) 383, 526
SsiI CCGC 3 cut(s) 504, 587, 605
SspMI CTAG 2 cut(s) 468, 746
StyD4I CCNGG 1 cut(s) 408
StyI CCWWGG 2 cut(s) 417, 704
TaaI ACNGT 1 cut(s) 691
TaiI ACGT 2 cut(s) 219, 226
TaqI TCGA 4 cut(s) 169, 441, 580, 646
TfiI GAWTC 3 cut(s) 209, 273, 472
Tru1I TTAA 3 cut(s) 110, 677, 693
Tru9I TTAA 3 cut(s) 110, 677, 693
TseFI GTSAC 2 cut(s) 217, 349
Tsp45I GTSAC 2 cut(s) 217, 349
TspDTI ATGAA 8 cut(s) 63, 86, 168, 212, 230, 320, 453, 650
VpaK11BI GGWCC 2 cut(s) 383, 526
VspI ATTAAT 1 cut(s) 110
XapI RAATTY 1 cut(s) 179
XspI CTAG 2 cut(s) 468, 746
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.