Rw1G008980

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000705
Physical Location & Seq
Forward (+)
19730818 .. 19731850
1033 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G008980.1

Sequence Viewer

Length: 903 bp
ATGTCCATCAAAGGAGCAAATTGGACAAGAAAGGAAGATGAAGCTCTTTGCATTGTGTTCATCCAAGTATCCGAAAACTCTGACAAAGGTACGAGCCAAAAAGAGACCGGCATTTGGAAACAAGTGGAGCAAAAGTTTAAAGAATTTTTCAATGGTGCTCCTCCGAATGTTAGAAATTTTGAGAGTTGTAAATCTCGATGGCAAAAAAACCTCTTCCCACAAATGAACAAATGGCATCAATGCGTCAAACGCGCCGAGAGGAGGATTCATAGCGGAGCTAATCAATCCGACCAACAACACTTAGCCGAAGATTTCTACAAGGACGATATGAATGGAAAAAATTTTCGCCATCAAAGTTGTTACAATTTGTGTAGCGATAGTTGGGTGATGTTTGATGATCCACCACTAGAAAACTTTGGTCCATCACCGGTGCAAAGAAACCTCCCTATTTCCTTGGAGGATGATGAAGAGCCAAATGGATCTACTTCGACACCAACTTCGACTCCAGATTCCCTTCCTAGACCAATGGGACGAAATATGGCAAGAAAACATAAATTGAAGGCCAAAGAAAAGGAGGAGAAAGCCTTTCAAGAAAAATTATTGGCTAACATGGAGCAAATGAGAGAAGAAAACATCAAAGCGGAAGAGGCAAAAGCCATAAGAGAGAAAATGAAGGAGGATCGACGAGAGAGGGACAGGGAAGAAGCCATTGTAATGATGCAAACCGTTGATTTTACTCCAAGGAGCAAGGCATATTTTGATGGGAAGAAGAGGGAAGCTCTTGAAAGGCTAAGGGCATGTGAGTTGTTTCCTAATTCCGCCACAACATCCAACGACTACCATCCACGTAGGGCAACCGAAGACGACTATCATCCACGTATGGCATCCGAAGATGACGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

300

Amino Acids

35.13

Weight (kDa)

6.24

Isoelectric Point (pI)

52.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 252
AciI CCGC 3 cut(s) 273, 641, 819
AclWI GGATC 3 cut(s) 392, 487, 687
AcsI RAATTY 3 cut(s) 143, 175, 340
AfaI GTAC 1 cut(s) 91
AfiI CCNNNNNNNGG 2 cut(s) 114, 261
AgeI ACCGGT 1 cut(s) 427
AgsI TTSAA 4 cut(s) 151, 559, 590, 785
AluBI AGCT 3 cut(s) 44, 278, 779
AluI AGCT 3 cut(s) 44, 278, 779
Alw21I GWGCWC 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 3 cut(s) 392, 487, 687
AoxI GGCC 1 cut(s) 561
ApoI RAATTY 3 cut(s) 143, 175, 340
ArsI GACNNNNNNTTYG 2 cut(s) 481, 513
AsiGI ACCGGT 1 cut(s) 427
AspLEI GCGC 1 cut(s) 254
AspS9I GGNCC 1 cut(s) 419
AsuHPI GGTGA 2 cut(s) 397, 417
AvaII GGWCC 1 cut(s) 419
BbsI GAAGAC 1 cut(s) 867
Bbv12I GWGCWC 1 cut(s) 160
BccI CCATC 6 cut(s) 14, 192, 357, 430, 755, 849
BciVI GTATCC 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 407, 519
BfuI GTATCC 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 419
BmgT120I GGNCC 1 cut(s) 419
BmsI GCATC 3 cut(s) 244, 708, 893
BpiI GAAGAC 1 cut(s) 867
BplI GAGNNNNNCTC 2 cut(s) 763, 795
BpmI CTGGAG 1 cut(s) 489
Bpu10I CCTNAGC 1 cut(s) 791
BsaAI YACGTR 2 cut(s) 848, 878
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 2 cut(s) 453, 740
BsaWI WCCGGW 1 cut(s) 427
BsaXI ACNNNNNCTCC 4 cut(s) 119, 149, 487, 517
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 261
Bse118I RCCGGY 2 cut(s) 107, 427
BseDI CCNNGG 2 cut(s) 453, 740
BseGI GGATG 6 cut(s) 60, 466, 827, 841, 871, 884
BseLI CCNNNNNNNGG 2 cut(s) 114, 261
BseRI GAGGAG 3 cut(s) 150, 274, 590
Bsh1236I CGCG 1 cut(s) 252
BshFI GGCC 1 cut(s) 563
BshTI ACCGGT 1 cut(s) 427
BsiHKAI GWGCWC 1 cut(s) 160
BsiSI CCGG 2 cut(s) 108, 428
BslFI GGGAC 2 cut(s) 543, 707
BslI CCNNNNNNNGG 2 cut(s) 114, 261
BsmAI GTCTC 1 cut(s) 98
BsmFI GGGAC 2 cut(s) 543, 707
BsnI GGCC 1 cut(s) 563
Bso31I GGTCTC 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 3 cut(s) 397, 479, 679
BspACI CCGC 3 cut(s) 273, 641, 819
BspANI GGCC 1 cut(s) 563
BspFNI CGCG 1 cut(s) 252
BspPI GGATC 3 cut(s) 392, 487, 687
BspQI GCTCTTC 1 cut(s) 462
BspTNI GGTCTC 1 cut(s) 98
BsrFI RCCGGY 2 cut(s) 107, 427
BssAI RCCGGY 2 cut(s) 107, 427
BssECI CCNNGG 2 cut(s) 453, 740
BssMI GATC 3 cut(s) 397, 479, 679
BssT1I CCWWGG 2 cut(s) 453, 740
Bst4CI ACNGT 1 cut(s) 727
Bst6I CTCTTC 4 cut(s) 218, 462, 639, 764
BstBAI YACGTR 2 cut(s) 848, 878
BstDEI CTNAG 2 cut(s) 301, 791
BstF5I GGATG 6 cut(s) 60, 466, 827, 841, 871, 884
BstFNI CGCG 1 cut(s) 252
BstHHI GCGC 1 cut(s) 254
BstKTI GATC 3 cut(s) 400, 482, 682
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 3 cut(s) 397, 479, 679
BstMWI GCNNNNNNNGC 2 cut(s) 249, 647
BstNSI RCATGY 1 cut(s) 801
BstUI CGCG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 867
BstX2I RGATCY 1 cut(s) 479
BstYI RGATCY 1 cut(s) 479
BsuI GTATCC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 563
BtsCI GGATG 6 cut(s) 60, 466, 827, 841, 871, 884
CfoI GCGC 1 cut(s) 254
Cfr10I RCCGGY 2 cut(s) 107, 427
Cfr13I GGNCC 1 cut(s) 419
CseI GACGC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 90
CspAI ACCGGT 1 cut(s) 427
CviAII CATG 2 cut(s) 610, 798
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 2 cut(s) 301, 791
DpnI GATC 3 cut(s) 399, 481, 681
DpnII GATC 3 cut(s) 397, 479, 679
DraI TTTAAA 1 cut(s) 139
Eam1104I CTCTTC 4 cut(s) 218, 462, 639, 764
EarI CTCTTC 4 cut(s) 218, 462, 639, 764
EciI GGCGGA 1 cut(s) 808
Eco130I CCWWGG 2 cut(s) 453, 740
Eco31I GGTCTC 1 cut(s) 98
Eco47I GGWCC 1 cut(s) 419
EcoT14I CCWWGG 2 cut(s) 453, 740
ErhI CCWWGG 2 cut(s) 453, 740
FaeI CATG 2 cut(s) 613, 801
FaiI YATR 9 cut(s) 270, 329, 539, 552, 611, 659, 754, 799, 881
FaqI GGGAC 2 cut(s) 543, 707
FatI CATG 2 cut(s) 609, 797
FokI GGATG 6 cut(s) 47, 473, 814, 828, 858, 871
FspBI CTAG 2 cut(s) 407, 519
GlaI GCGC 1 cut(s) 253
GsuI CTGGAG 1 cut(s) 489
HaeIII GGCC 1 cut(s) 563
HapII CCGG 2 cut(s) 108, 428
HgaI GACGC 1 cut(s) 232
HhaI GCGC 1 cut(s) 254
Hin1II CATG 2 cut(s) 613, 801
Hin6I GCGC 1 cut(s) 252
HinP1I GCGC 1 cut(s) 252
HinfI GANTC 3 cut(s) 265, 502, 509
HpaII CCGG 2 cut(s) 108, 428
HphI GGTGA 2 cut(s) 397, 417
Hpy188I TCNGA 5 cut(s) 73, 82, 165, 289, 889
Hpy188III TCNNGA 4 cut(s) 195, 506, 590, 782
Hpy99I CGWCG 1 cut(s) 687
HpyAV CCTTC 3 cut(s) 524, 553, 667
HpyCH4III ACNGT 1 cut(s) 727
HpyCH4IV ACGT 2 cut(s) 847, 877
HpyCH4V TGCA 3 cut(s) 51, 433, 721
HpyF10VI GCNNNNNNNGC 2 cut(s) 249, 647
HpyF3I CTNAG 2 cut(s) 301, 791
HpySE526I ACGT 2 cut(s) 847, 877
Hsp92II CATG 2 cut(s) 613, 801
HspAI GCGC 1 cut(s) 252
Kzo9I GATC 3 cut(s) 397, 479, 679
LguI GCTCTTC 1 cut(s) 462
LmnI GCTCC 6 cut(s) 14, 127, 163, 275, 613, 744
LpnPI CCDG 4 cut(s) 121, 441, 519, 682
LweI GCATC 3 cut(s) 244, 708, 893
MaeI CTAG 2 cut(s) 407, 519
MaeII ACGT 2 cut(s) 847, 877
MaeIII GTNAC 1 cut(s) 359
MalI GATC 3 cut(s) 399, 481, 681
MboI GATC 3 cut(s) 397, 479, 679
MflI RGATCY 1 cut(s) 479
MhlI GDGCHC 1 cut(s) 160
MluCI AATT 8 cut(s) 19, 143, 175, 340, 364, 554, 596, 814
MlyI GAGTC 1 cut(s) 496
MmeI TCCRAC 2 cut(s) 312, 855
MseI TTAA 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 713
MspI CCGG 2 cut(s) 108, 428
MvnI CGCG 1 cut(s) 252
MwoI GCNNNNNNNGC 2 cut(s) 249, 647
NdeII GATC 3 cut(s) 397, 479, 679
NlaIII CATG 2 cut(s) 613, 801
NmeAIII GCCGAG 1 cut(s) 280
NspI RCATGY 1 cut(s) 801
PciSI GCTCTTC 1 cut(s) 462
PfeI GAWTC 2 cut(s) 265, 509
PinAI ACCGGT 1 cut(s) 427
PleI GAGTC 1 cut(s) 496
PpsI GAGTC 1 cut(s) 496
Ppu21I YACGTR 2 cut(s) 848, 878
PspPI GGNCC 1 cut(s) 419
PsuI RGATCY 1 cut(s) 479
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
RseI CAYNNNNRTG 1 cut(s) 713
SapI GCTCTTC 1 cut(s) 462
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 3 cut(s) 397, 479, 679
Sau96I GGNCC 1 cut(s) 419
SchI GAGTC 1 cut(s) 496
SduI GDGCHC 1 cut(s) 160
SetI ASST 8 cut(s) 46, 91, 213, 280, 444, 781, 850, 880
SfaNI GCATC 3 cut(s) 244, 708, 893
SgrAI CRCCGGYG 1 cut(s) 427
SinI GGWCC 1 cut(s) 419
SmiMI CAYNNNNRTG 1 cut(s) 713
Sse9I AATT 8 cut(s) 19, 143, 175, 340, 364, 554, 596, 814
SsiI CCGC 3 cut(s) 273, 641, 819
SspMI CTAG 2 cut(s) 407, 519
StyI CCWWGG 2 cut(s) 453, 740
TaaI ACNGT 1 cut(s) 727
TaiI ACGT 2 cut(s) 850, 880
TaqI TCGA 4 cut(s) 196, 488, 500, 682
TasI AATT 8 cut(s) 19, 143, 175, 340, 364, 554, 596, 814
TfiI GAWTC 2 cut(s) 265, 509
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 7 cut(s) 49, 54, 239, 257, 344, 480, 686
VpaK11BI GGWCC 1 cut(s) 419
XapI RAATTY 3 cut(s) 143, 175, 340
XceI RCATGY 1 cut(s) 801
XspI CTAG 2 cut(s) 407, 519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.