Rmu_sc0005742.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005742.1
OG0000705
Physical Location & Seq
Forward (+)
2077 .. 2415
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005742.1_g000002.1.cds

Sequence Viewer

Length: 339 bp
atgactagttcgtcgaaaagaagtgtgaattggtcatcgttggaagatgaagcactcacccattctccaccaacaacttctccaactgaaaatcctaggccaattgggcaaaatgcagcaagaagaagacttgccaagagaaaagaagccgaaagtaacgttggagaagaaatggtggcagacctaaatcaactaagagaagatctccagaaatcaaaggaggaaagaacaagaagagatcaagtcaaggaagagagaagagaacgtgatagggaagaagctattttagcaatgcaaaccatcaattttactcctttgagtaaagagtattatgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.05

Weight (kDa)

5.97

Isoelectric Point (pI)

76.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 10
AclI AACGTT 1 cut(s) 159
AhlI ACTAGT 1 cut(s) 5
AjuI GAANNNNNNNTTGG 4 cut(s) 13, 45, 144, 176
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
AoxI GGCC 1 cut(s) 98
ApeKI GCWGC 1 cut(s) 116
AspA2I CCTAGG 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 49
AvrII CCTAGG 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 133
BbvI GCAGC 1 cut(s) 128
BccI CCATC 1 cut(s) 308
BcuI ACTAGT 1 cut(s) 5
BfaI CTAG 2 cut(s) 6, 96
BglI GCCNNNNNGGC 1 cut(s) 106
BglII AGATCT 1 cut(s) 202
BisI GCNGC 1 cut(s) 117
BlnI CCTAGG 1 cut(s) 95
BlsI GCNGC 1 cut(s) 118
BpiI GAAGAC 1 cut(s) 133
BplI GAGNNNNNCTC 2 cut(s) 189, 221
BpmI CTGGAG 1 cut(s) 191
BsaJI CCNNGG 1 cut(s) 95
BsaXI ACNNNNNCTCC 4 cut(s) 49, 64, 79, 94
Bse3DI GCAATG 1 cut(s) 297
BseDI CCNNGG 1 cut(s) 95
BseMI GCAATG 1 cut(s) 297
BseXI GCAGC 1 cut(s) 128
BshFI GGCC 1 cut(s) 100
BsnI GGCC 1 cut(s) 100
Bsp143I GATC 2 cut(s) 202, 238
BspANI GGCC 1 cut(s) 100
BsrDI GCAATG 1 cut(s) 297
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 2 cut(s) 202, 238
BssT1I CCWWGG 1 cut(s) 95
Bst6I CTCTTC 3 cut(s) 229, 246, 253
BstDEI CTNAG 1 cut(s) 194
BstKTI GATC 2 cut(s) 205, 241
BstMBI GATC 2 cut(s) 202, 238
BstMWI GCNNNNNNNGC 2 cut(s) 106, 287
BstV1I GCAGC 1 cut(s) 128
BstV2I GAAGAC 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BsuRI GGCC 1 cut(s) 100
CviJI RGCY 3 cut(s) 100, 149, 281
CviKI_1 RGCY 3 cut(s) 100, 149, 281
DdeI CTNAG 1 cut(s) 194
DpnI GATC 2 cut(s) 204, 240
DpnII GATC 2 cut(s) 202, 238
DrdI GACNNNNNNGTC 1 cut(s) 10
DseDI GACNNNNNNGTC 1 cut(s) 10
Eam1104I CTCTTC 3 cut(s) 229, 246, 253
EarI CTCTTC 3 cut(s) 229, 246, 253
Eco130I CCWWGG 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 95
FaiI YATR 1 cut(s) 333
Fnu4HI GCNGC 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 117
FspBI CTAG 2 cut(s) 6, 96
GluI GCNGC 1 cut(s) 117
GsuI CTGGAG 1 cut(s) 191
HaeIII GGCC 1 cut(s) 100
HphI GGTGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 208
Hpy99I CGWCG 1 cut(s) 16
HpyCH4IV ACGT 2 cut(s) 159, 265
HpyCH4V TGCA 2 cut(s) 116, 295
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 287
HpyF3I CTNAG 1 cut(s) 194
HpySE526I ACGT 2 cut(s) 159, 265
Kzo9I GATC 2 cut(s) 202, 238
LpnPI CCDG 1 cut(s) 221
Lsp1109I GCAGC 1 cut(s) 128
MaeI CTAG 2 cut(s) 6, 96
MaeII ACGT 2 cut(s) 159, 265
MaeIII GTNAC 1 cut(s) 155
MalI GATC 2 cut(s) 204, 240
MboI GATC 2 cut(s) 202, 238
MboII GAAGA 9 cut(s) 56, 135, 138, 179, 212, 246, 263, 270, 287
MfeI CAATTG 1 cut(s) 102
MflI RGATCY 1 cut(s) 202
MluCI AATT 3 cut(s) 28, 102, 304
MmeI TCCRAC 3 cut(s) 21, 107, 142
MnlI CCTC 1 cut(s) 214
MunI CAATTG 1 cut(s) 102
MwoI GCNNNNNNNGC 2 cut(s) 106, 287
NdeII GATC 2 cut(s) 202, 238
PkrI GCNGC 1 cut(s) 118
Psp1406I AACGTT 1 cut(s) 159
PsuI RGATCY 1 cut(s) 202
SatI GCNGC 1 cut(s) 117
Sau3AI GATC 2 cut(s) 202, 238
SetI ASST 4 cut(s) 162, 186, 268, 283
SpeI ACTAGT 1 cut(s) 5
Sse9I AATT 3 cut(s) 28, 102, 304
SspMI CTAG 2 cut(s) 6, 96
StyI CCWWGG 1 cut(s) 95
TaiI ACGT 2 cut(s) 162, 268
TaqI TCGA 1 cut(s) 14
TasI AATT 3 cut(s) 28, 102, 304
TseI GCWGC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 63
XmaJI CCTAGG 1 cut(s) 95
XspI CTAG 2 cut(s) 6, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.