MD14G1015600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Forward (+)
1396555 .. 1399918
3364 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1015600.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGATGATAGGAATATGCAAAGGAACAATTTGGATTACACTATAATGAGTAACGCCTATTTTGATAGGAAAAAGAGGAAAATTATGACCCGGCGACATTTGTTTATCTTCGACTATACTCCTACAATGACAGATGATGAAGATGATATTGATTATGAACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.77

Weight (kDa)

4.83

Isoelectric Point (pI)

39.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000705)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23932 FvH4_3g35672 FvH4_4g18641 FvH4_7g17721
malus_domestica MD03G1177400.v1.1 MD07G1181800.v1.1 MD08G1042000.v1.1 MD08G1109500.v1.1 MD10G1235600.v1.1 MD14G1015600.v1.1 MD17G1218600.v1.1
prunus_persica Prupe.3G094000_v2.0.a1 Prupe.4G233800_v2.0.a1
pyrus_communis pycom05g03000 pycom06g19840 pycom08g03390 pycom08g03420 pycom09g12380 pycom11g05900 pycom13g28390 pycom13g28400 pycom14g03000 pycom16g13550 pycom16g13560 pycom16g25710 pycom17g22320
rosa_chinensis RchiOBHm_Chr2g0111501 RchiOBHm_Chr3g0494851 RchiOBHm_Chr4g0406761 RchiOBHm_Chr6g0260681 RchiOBHm_Chr6g0298551
rosa_laevigata RLG00000002080 RLG00000002250 RLG00000002368 RLG00000012994 RLG00000017948 RLG00000022683
rosa_multiflora Rmu_sc0000441.1_g000135 Rmu_sc0000610.1_g000022 Rmu_sc0000861.1_g000009 Rmu_sc0000938.1_g000012 Rmu_sc0001551.1_g000021 Rmu_sc0001685.1_g000059 Rmu_sc0002132.1_g000058 Rmu_sc0002539.1_g000108 Rmu_sc0002856.1_g000004 Rmu_sc0002868.1_g000022 Rmu_sc0003642.1_g000004 Rmu_sc0005394.1_g000003 Rmu_sc0005742.1_g000002 Rmu_sc0006138.1_g000008 Rmu_sc0006320.1_g000009 Rmu_sc0006616.1_g000006 Rmu_sc0007485.1_g000021 Rmu_sc0008518.1_g000027 Rmu_sc0010999.1_g000017 Rmu_sc0011648.1_g000001 Rmu_sc0013558.1_g000009 Rmu_sc0013665.1_g000001 Rmu_sc0014762.1_g000006 Rmu_ssc0000050.1_g000057
rosa_roxburghii Rroxscaffold_1G00024040
rosa_samantha Rh1CG033000 Rh1CG207600 Rh6CG418600
rosa_wichuraiana Rw1G008980 Rw1G034040 Rw4G013350 Rw4G032310 Rw5G001190 Rw5G026320 Rw5G038830 Rw6G008970 Rw7G034950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AsuC2I CCSGG 1 cut(s) 91
BcnI CCSGG 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 91
BpuMI CCSGG 1 cut(s) 91
BseGI GGATG 1 cut(s) 10
BsiSI CCGG 1 cut(s) 91
BstF5I GGATG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 89
BtsCI GGATG 1 cut(s) 10
FaiI YATR 5 cut(s) 17, 44, 86, 117, 156
FokI GGATG 1 cut(s) 17
FspEI CC 9 cut(s) 7, 17, 52, 61, 70, 76, 103, 104, 135
HapII CCGG 1 cut(s) 91
HpaII CCGG 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 19
LpnPI CCDG 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 50
MboII GAAGA 2 cut(s) 100, 152
MluCI AATT 2 cut(s) 28, 81
MnlI CCTC 1 cut(s) 69
MseI TTAA 1 cut(s) 163
MslI CAYNNNNRTG 1 cut(s) 44
MspI CCGG 1 cut(s) 91
MspR9I CCNGG 1 cut(s) 91
NciI CCSGG 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 44
SaqAI TTAA 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 91
SgeI CNNG 2 cut(s) 102, 103
SmiMI CAYNNNNRTG 1 cut(s) 44
Sse9I AATT 2 cut(s) 28, 81
StyD4I CCNGG 1 cut(s) 89
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 28, 81
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.