MD05G1076500.v1.1

Carboxylesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0000397
Physical Location & Seq
Reverse (-)
16338468 .. 16339661
1194 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1076500.v1.1.491

Sequence Viewer

Length: 303 bp
ATGGCCTGTTTGTGGCGGTTTGTGTACCCATTGAGTAATGGAATCGATGATCTGCTTTTCAACCCGATTAATGATCCGAAACTGAGGAACTTGGGGTGTCAGAAGGTGTTGGTTTTTGTTGATGAGAAAGACACGTTGTATGATAGGGGAAGGTATTATAGTATGGCACTAAGAAAGAGTGGATGGAAAAGGGCTGTAAAGGTATGGAAAACAAAGGAGGAGAACCATGTATTCCATTTGTTCCAACCCGCTAATGAAAAAGCTGTGGCCATGATGAAAAGGATCGTTTTGTTCTTCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

101

Amino Acids

11.88

Weight (kDa)

9.65

Isoelectric Point (pI)

32.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 1 - 79 2.9e-09 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000397)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G48690 AT3G48700
fragaria_vesca FvH4_2g06400 FvH4_2g06430 FvH4_2g06450 FvH4_2g06480 FvH4_2g06560
malus_domestica MD05G1076400.v1.1 MD05G1076500.v1.1 MD05G1078900.v1.1 MD05G1191000.v1.1 MD05G1191100.v1.1 MD08G1226300.v1.1 MD10G1091000.v1.1 MD10G1091200.v1.1 MD10G1091400.v1.1 MD10G1091600.v1.1 MD10G1091900.v1.1
prunus_persica Prupe.8G120800_v2.0.a1 Prupe.8G121100_v2.0.a1 Prupe.8G121200_v2.0.a1 Prupe.8G121300_v2.0.a1 Prupe.8G121400_v2.0.a1 Prupe.8G121500_v2.0.a1 Prupe.8G121600_v2.0.a1 Prupe.8G121700_v2.0.a1 Prupe.8G121900_v2.0.a1 Prupe.8G122000_v2.0.a1 Prupe.I000800_v2.0.a1
pyrus_communis pycom05g07040 pycom05g17560 pycom05g17680 pycom05g17760 pycom10g07450 pycom10g07470 pycom10g07550
rosa_chinensis RchiOBHm_Chr6g0258271 RchiOBHm_Chr6g0258281 RchiOBHm_Chr6g0258291 RchiOBHm_Chr6g0258311 RchiOBHm_Chr6g0258321 RchiOBHm_Chr6g0258501
rosa_laevigata RLG00000014606 RLG00000014621 RLG00000014622 RLG00000014624 RLG00000014625 RLG00000014627 RLG00000014629 RLG00000014633 RLG00000014635
rosa_multiflora Rmu_co8014592.1_g000001 Rmu_co8366243.1_g000001 Rmu_sc0001663.1_g000004 Rmu_sc0005877.1_g000001 Rmu_sc0005877.1_g000006 Rmu_sc0005877.1_g000007 Rmu_sc0007367.1_g000009 Rmu_sc0007367.1_g000019 Rmu_sc0010616.1_g000022 Rmu_sc0010616.1_g000023 Rmu_ssc0000213.1_g000009
rosa_roxburghii Rroxscaffold_178G00437230 Rroxscaffold_178G00437250 Rroxscaffold_178G00437280 Rroxscaffold_178G00437320 Rroxscaffold_178G00437340 Rroxscaffold_178G00437350 Rroxscaffold_178G00437480 Rroxscaffold_7G00205390 Rroxscaffold_7G00205410 Rroxscaffold_7G00205450 Rroxscaffold_7G00205490 Rroxscaffold_7G00205510 Rroxscaffold_7G00205520 Rroxscaffold_7G00205670 Rroxscaffold_7G00205730
rosa_rugosa Rorug05G0579800 Rorug05G0580500 Rorug05G0580600 Rorug05G0580700 Rorug05G0580900 Rorug05G0581000 Rorug05G0581900
rosa_samantha Rh6CG084800 Rh6CG085100 Rh6CG085200 Rh6CG085400 Rh6CG085500 Rh6CG085600 Rh6CG085700 Rh6CG086900
rosa_wichuraiana Rw6G008300 Rw6G008310 Rw6G008360 Rw6G008370 Rw6G008380 Rw6G008390 Rw6G008430 Rw6G008440 Rw6G008530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 16, 249
AclWI GGATC 2 cut(s) 68, 290
AcoI YGGCCR 1 cut(s) 267
AfaI GTAC 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 12
AflIII ACRYGT 1 cut(s) 132
AgsI TTSAA 2 cut(s) 61, 298
AluBI AGCT 1 cut(s) 263
AluI AGCT 1 cut(s) 263
AlwI GGATC 2 cut(s) 68, 290
AoxI GGCC 2 cut(s) 3, 267
AseI ATTAAT 1 cut(s) 69
BalI TGGCCA 1 cut(s) 269
BccI CCATC 1 cut(s) 177
Bsa29I ATCGAT 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 12
BseCI ATCGAT 1 cut(s) 45
BseGI GGATG 1 cut(s) 188
BseLI CCNNNNNNNGG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 233
BshFI GGCC 2 cut(s) 5, 269
BshVI ATCGAT 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 12
BsnI GGCC 2 cut(s) 5, 269
Bsp143I GATC 3 cut(s) 49, 73, 282
BspACI CCGC 2 cut(s) 16, 249
BspANI GGCC 2 cut(s) 5, 269
BspCNI CTCAG 1 cut(s) 75
BspDI ATCGAT 1 cut(s) 45
BspPI GGATC 2 cut(s) 68, 290
BssMI GATC 3 cut(s) 49, 73, 282
BstDEI CTNAG 2 cut(s) 83, 170
BstF5I GGATG 1 cut(s) 188
BstKTI GATC 3 cut(s) 52, 76, 285
BstMBI GATC 3 cut(s) 49, 73, 282
Bsu15I ATCGAT 1 cut(s) 45
BsuRI GGCC 2 cut(s) 5, 269
BsuTUI ATCGAT 1 cut(s) 45
BtsCI GGATG 1 cut(s) 188
ClaI ATCGAT 1 cut(s) 45
Csp6I GTAC 1 cut(s) 25
CviAII CATG 2 cut(s) 227, 271
CviJI RGCY 4 cut(s) 5, 194, 263, 269
CviKI_1 RGCY 4 cut(s) 5, 194, 263, 269
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 2 cut(s) 83, 170
DpnI GATC 3 cut(s) 51, 75, 284
DpnII GATC 3 cut(s) 49, 73, 282
EaeI YGGCCR 1 cut(s) 267
FaeI CATG 2 cut(s) 230, 274
FaiI YATR 6 cut(s) 141, 159, 164, 205, 228, 272
FatI CATG 2 cut(s) 226, 270
FauI CCCGC 1 cut(s) 256
FokI GGATG 1 cut(s) 195
HaeIII GGCC 2 cut(s) 5, 269
Hin1II CATG 2 cut(s) 230, 274
HinfI GANTC 1 cut(s) 42
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 78, 102
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 97, 144
HpyCH4IV ACGT 1 cut(s) 134
HpyF3I CTNAG 2 cut(s) 83, 170
HpySE526I ACGT 1 cut(s) 134
Hsp92II CATG 2 cut(s) 230, 274
Kzo9I GATC 3 cut(s) 49, 73, 282
LpnPI CCDG 1 cut(s) 19
MaeII ACGT 1 cut(s) 134
MalI GATC 3 cut(s) 51, 75, 284
MboI GATC 3 cut(s) 49, 73, 282
MboII GAAGA 1 cut(s) 286
MlsI TGGCCA 1 cut(s) 269
MluCI AATT 1 cut(s) 298
MluNI TGGCCA 1 cut(s) 269
MmeI TCCRAC 1 cut(s) 268
MnlI CCTC 2 cut(s) 78, 211
Mox20I TGGCCA 1 cut(s) 269
MscI TGGCCA 1 cut(s) 269
MseI TTAA 1 cut(s) 69
Msp20I TGGCCA 1 cut(s) 269
NdeII GATC 3 cut(s) 49, 73, 282
NlaIII CATG 2 cut(s) 230, 274
PfeI GAWTC 1 cut(s) 42
PshBI ATTAAT 1 cut(s) 69
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
SaqAI TTAA 1 cut(s) 69
Sau3AI GATC 3 cut(s) 49, 73, 282
SetI ASST 5 cut(s) 108, 137, 155, 204, 265
SgeI CNNG 7 cut(s) 18, 76, 103, 145, 239, 260, 283
Sse9I AATT 1 cut(s) 298
SsiI CCGC 2 cut(s) 16, 249
TaiI ACGT 1 cut(s) 137
TaqI TCGA 1 cut(s) 45
TasI AATT 1 cut(s) 298
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TspDTI ATGAA 2 cut(s) 270, 290
VspI ATTAAT 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.