Rmu_sc0005877.1_g000001

Carboxylesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005877.1
OG0000397
Physical Location & Seq
Forward (+)
8798 .. 10496
1699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005877.1_g000001.1.cds

Sequence Viewer

Length: 1359 bp
atgagcgacgaactagcccatgatttctctcccatgatcaaagtatacaaagacggtcgaatcgaccgaccctggggaacaaccacagtccctgcatccatcgatccccaaaccggtgttcaatccaaagacgtcgtcatctcaaccgcaccacccatctctgtaaggctttacattccgaaatccaacacaaccgagtcagccgagtcaacccggaagctccctcttctggtttactttcacggcggtgccttctgcattggaagtgctttctctcgcatatgtcacaaccactgcaactctttagtctctgaagccaatgttgtagctgtttctgttgactataggttggtgccggagcaccctcttccggctgcctatgaagattcatgggccgctctcaaatgggtggagtcccatttcgccggaaccggcccggaagagtggctgaaccggcatgccgatttgaaccgggttttcttttcaggtgatagcgctggggcaaacatagctcaccacatgggtttgagagttgggtctgagaaattggtgtattttaagctgaatgggattgttctggtgcatccatacttttggggtgaagaaccagtaggcggagaggtagctttgggcgagagtcatagagagcatttgcatgctttgtggaggtttgcttaccctttgactagtggatctgatgacccgctttttaatccgggtaaggatccgaagttgggggagttgggttgtgagaaagtgttggtctgtgttgcggagaaggatgcgttgaaagataggggctggtattacagtgaggtgttgaagaagagtggatggaatggagtagtagaggttttggaaacaaaggaggagcagcatgtgttccatttgatcaatcctagttgtgacaatgctgtgaccatgctcaagaagattgtttctttcatgaattatacttgcgggcagaaagagagagagaaaaaccctaaggtcggaggcgcggccgaattagaccgcaagatcgcttctcgtccggtggcgacctgggcctctaggctggcttttggcctcaccgacgccgtgaggggaacgttctctttctgcggcggcgtggatcacaggtgctggactggggcgagatgtggtgttgcttggtgtggtggcactgctccggaggtgattaggtcgtggcggttgaatcgtggtggcggatcatggcggtgcaggagtggcatggttggcggagcaaagctggaactggtgatgctggtcagcgtgtttggagagaaggctgggcctggaccctgtcgggcctgttgggctttgggtgggcttctctttggatttgccttacactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

452

Amino Acids

49.51

Weight (kDa)

7.58

Isoelectric Point (pI)

25.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000397)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G48690 AT3G48700
fragaria_vesca FvH4_2g06400 FvH4_2g06430 FvH4_2g06450 FvH4_2g06480 FvH4_2g06560
malus_domestica MD05G1076400.v1.1 MD05G1076500.v1.1 MD05G1078900.v1.1 MD05G1191000.v1.1 MD05G1191100.v1.1 MD08G1226300.v1.1 MD10G1091000.v1.1 MD10G1091200.v1.1 MD10G1091400.v1.1 MD10G1091600.v1.1 MD10G1091900.v1.1
prunus_persica Prupe.8G120800_v2.0.a1 Prupe.8G121100_v2.0.a1 Prupe.8G121200_v2.0.a1 Prupe.8G121300_v2.0.a1 Prupe.8G121400_v2.0.a1 Prupe.8G121500_v2.0.a1 Prupe.8G121600_v2.0.a1 Prupe.8G121700_v2.0.a1 Prupe.8G121900_v2.0.a1 Prupe.8G122000_v2.0.a1 Prupe.I000800_v2.0.a1
pyrus_communis pycom05g07040 pycom05g17560 pycom05g17680 pycom05g17760 pycom10g07450 pycom10g07470 pycom10g07550
rosa_chinensis RchiOBHm_Chr6g0258271 RchiOBHm_Chr6g0258281 RchiOBHm_Chr6g0258291 RchiOBHm_Chr6g0258311 RchiOBHm_Chr6g0258321 RchiOBHm_Chr6g0258501
rosa_laevigata RLG00000014606 RLG00000014621 RLG00000014622 RLG00000014624 RLG00000014625 RLG00000014627 RLG00000014629 RLG00000014633 RLG00000014635
rosa_multiflora Rmu_co8014592.1_g000001 Rmu_co8366243.1_g000001 Rmu_sc0001663.1_g000004 Rmu_sc0005877.1_g000001 Rmu_sc0005877.1_g000006 Rmu_sc0005877.1_g000007 Rmu_sc0007367.1_g000009 Rmu_sc0007367.1_g000019 Rmu_sc0010616.1_g000022 Rmu_sc0010616.1_g000023 Rmu_ssc0000213.1_g000009
rosa_roxburghii Rroxscaffold_178G00437230 Rroxscaffold_178G00437250 Rroxscaffold_178G00437280 Rroxscaffold_178G00437320 Rroxscaffold_178G00437340 Rroxscaffold_178G00437350 Rroxscaffold_178G00437480 Rroxscaffold_7G00205390 Rroxscaffold_7G00205410 Rroxscaffold_7G00205450 Rroxscaffold_7G00205490 Rroxscaffold_7G00205510 Rroxscaffold_7G00205520 Rroxscaffold_7G00205670 Rroxscaffold_7G00205730
rosa_rugosa Rorug05G0579800 Rorug05G0580500 Rorug05G0580600 Rorug05G0580700 Rorug05G0580900 Rorug05G0581000 Rorug05G0581900
rosa_samantha Rh6CG084800 Rh6CG085100 Rh6CG085200 Rh6CG085400 Rh6CG085500 Rh6CG085600 Rh6CG085700 Rh6CG086900
rosa_wichuraiana Rw6G008300 Rw6G008310 Rw6G008360 Rw6G008370 Rw6G008380 Rw6G008390 Rw6G008430 Rw6G008440 Rw6G008530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 135
AccB1I GGYRCC 2 cut(s) 248, 352
AccBSI CCGCTC 1 cut(s) 398
AccI GTMKAC 1 cut(s) 45
AccII CGCG 1 cut(s) 1001
AccIII TCCGGA 1 cut(s) 1171
AclI AACGTT 1 cut(s) 1091
AclWI GGATC 6 cut(s) 98, 700, 719, 732, 1122, 1219
AcoI YGGCCR 1 cut(s) 1002
AcuI CTGAAG 1 cut(s) 333
AcyI GRCGYC 2 cut(s) 132, 1077
AfeI AGCGCT 1 cut(s) 496
AfiI CCNNNNNNNGG 7 cut(s) 73, 113, 229, 370, 614, 734, 992
AgeI ACCGGT 1 cut(s) 113
AgsI TTSAA 5 cut(s) 122, 469, 790, 823, 1198
AhlI ACTAGT 1 cut(s) 686
AjnI CCWGG 3 cut(s) 71, 1043, 1297
AjuI GAANNNNNNNTTGG 2 cut(s) 102, 134
AleI CACNNNNGTG 1 cut(s) 246
AluBI AGCT 6 cut(s) 220, 329, 512, 562, 626, 1252
AluI AGCT 6 cut(s) 220, 329, 512, 562, 626, 1252
Alw21I GWGCWC 1 cut(s) 363
Alw26I GTCTC 1 cut(s) 313
AlwI GGATC 6 cut(s) 98, 700, 719, 732, 1122, 1219
AlwNI CAGNNNCTG 2 cut(s) 92, 1125
Aor13HI TCCGGA 1 cut(s) 1171
Aor51HI AGCGCT 1 cut(s) 496
AoxI GGCC 7 cut(s) 393, 433, 1002, 1047, 1066, 1295, 1311
ApeKI GCWGC 2 cut(s) 374, 874
ArsI GACNNNNNNTTYG 2 cut(s) 120, 152
AsiGI ACCGGT 1 cut(s) 113
AspLEI GCGC 2 cut(s) 497, 1001
AspS9I GGNCC 6 cut(s) 393, 434, 1047, 1295, 1301, 1311
AsuC2I CCSGG 4 cut(s) 214, 437, 473, 717
AsuHPI GGTGA 6 cut(s) 500, 506, 611, 1063, 1189, 1273
AvaII GGWCC 1 cut(s) 1301
AxyI CCTNAGG 1 cut(s) 987
BamHI GGATCC 1 cut(s) 724
BanI GGYRCC 2 cut(s) 248, 352
Bbv12I GWGCWC 1 cut(s) 363
BbvI GCAGC 2 cut(s) 361, 886
BccI CCATC 3 cut(s) 107, 164, 828
BceAI ACGGC 2 cut(s) 259, 1064
BciT130I CCWGG 3 cut(s) 73, 1045, 1299
BclI TGATCA 2 cut(s) 36, 891
BcnI CCSGG 4 cut(s) 214, 437, 473, 717
BcoDI GTCTC 1 cut(s) 313
BcuI ACTAGT 1 cut(s) 686
BfaI CTAG 4 cut(s) 14, 687, 900, 1053
BfmI CTRYAG 1 cut(s) 343
BfoI RGCGCY 1 cut(s) 498
BglI GCCNNNNNGGC 1 cut(s) 1319
BisI GCNGC 6 cut(s) 375, 396, 875, 1002, 1105, 1108
BlsI GCNGC 6 cut(s) 376, 397, 876, 1003, 1106, 1109
Bme1390I CCNGG 7 cut(s) 73, 214, 437, 473, 717, 1045, 1299
Bme18I GGWCC 1 cut(s) 1301
BmgT120I GGNCC 6 cut(s) 393, 434, 1047, 1295, 1301, 1311
BmiI GGNNCC 5 cut(s) 250, 354, 430, 726, 1303
BmrFI CCNGG 7 cut(s) 73, 214, 437, 473, 717, 1045, 1299
BmrI ACTGGG 1 cut(s) 1140
BmsI GCATC 4 cut(s) 104, 592, 772, 1254
BmuI ACTGGG 1 cut(s) 1140
BpuEI CTTGAG 1 cut(s) 911
BpuMI CCSGG 4 cut(s) 214, 437, 473, 717
Bsa29I ATCGAT 1 cut(s) 102
BsaHI GRCGYC 2 cut(s) 132, 1077
BsaJI CCNNGG 3 cut(s) 71, 72, 1044
BsaWI WCCGGW 3 cut(s) 113, 1033, 1171
Bsc4I CCNNNNNNNGG 7 cut(s) 73, 113, 229, 370, 614, 734, 992
Bse118I RCCGGY 3 cut(s) 113, 431, 453
Bse1I ACTGG 3 cut(s) 608, 1135, 1263
Bse21I CCTNAGG 1 cut(s) 987
BseAI TCCGGA 1 cut(s) 1171
BseBI CCWGG 3 cut(s) 73, 1045, 1299
BseCI ATCGAT 1 cut(s) 102
BseDI CCNNGG 3 cut(s) 71, 72, 1044
BseGI GGATG 4 cut(s) 95, 583, 787, 839
BseLI CCNNNNNNNGG 7 cut(s) 73, 113, 229, 370, 614, 734, 992
BseMII CTCAG 1 cut(s) 531
BseNI ACTGG 3 cut(s) 608, 1135, 1263
BseRI GAGGAG 1 cut(s) 884
BseX3I CGGCCG 1 cut(s) 1002
BseXI GCAGC 2 cut(s) 361, 886
BseYI CCCAGC 2 cut(s) 497, 1292
BsgI GTGCAG 1 cut(s) 1243
Bsh1236I CGCG 1 cut(s) 1001
Bsh1285I CGRYCG 3 cut(s) 58, 67, 1005
BshFI GGCC 7 cut(s) 395, 435, 1004, 1049, 1068, 1297, 1313
BshNI GGYRCC 2 cut(s) 248, 352
BshTI ACCGGT 1 cut(s) 113
BshVI ATCGAT 1 cut(s) 102
BsiEI CGRYCG 3 cut(s) 58, 67, 1005
BsiHKAI GWGCWC 1 cut(s) 363
BslFI GGGAC 2 cut(s) 74, 400
BslI CCNNNNNNNGG 7 cut(s) 73, 113, 229, 370, 614, 734, 992
BsmAI GTCTC 1 cut(s) 313
BsmFI GGGAC 2 cut(s) 74, 400
BsnI GGCC 7 cut(s) 395, 435, 1004, 1049, 1068, 1297, 1313
Bsp1286I GDGCHC 1 cut(s) 363
Bsp13I TCCGGA 1 cut(s) 1171
Bsp143I GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
BspANI GGCC 7 cut(s) 395, 435, 1004, 1049, 1068, 1297, 1313
BspCNI CTCAG 1 cut(s) 532
BspDI ATCGAT 1 cut(s) 102
BspEI TCCGGA 1 cut(s) 1171
BspFNI CGCG 1 cut(s) 1001
BspHI TCATGA 1 cut(s) 945
BspLI GGNNCC 5 cut(s) 250, 354, 430, 726, 1303
BspPI GGATC 6 cut(s) 98, 700, 719, 732, 1122, 1219
BspT107I GGYRCC 2 cut(s) 248, 352
BsrBI CCGCTC 1 cut(s) 398
BsrFI RCCGGY 3 cut(s) 113, 431, 453
BsrI ACTGG 3 cut(s) 608, 1135, 1263
BssAI RCCGGY 3 cut(s) 113, 431, 453
BssECI CCNNGG 3 cut(s) 71, 72, 1044
BssMI GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
BssNAI GTATAC 1 cut(s) 46
BssNI GRCGYC 2 cut(s) 132, 1077
Bst1107I GTATAC 1 cut(s) 46
Bst2UI CCWGG 3 cut(s) 73, 1045, 1299
Bst4CI ACNGT 3 cut(s) 56, 88, 812
Bst6I CTCTTC 4 cut(s) 231, 372, 435, 821
BstACI GRCGYC 2 cut(s) 132, 1077
BstC8I GCNNGC 4 cut(s) 459, 657, 962, 1059
BstDEI CTNAG 2 cut(s) 540, 987
BstF5I GGATG 4 cut(s) 95, 583, 787, 839
BstFNI CGCG 1 cut(s) 1001
BstH2I RGCGCY 1 cut(s) 498
BstHHI GCGC 2 cut(s) 497, 1001
BstKTI GATC 8 cut(s) 39, 106, 695, 727, 894, 1023, 1117, 1214
BstMAI GTCTC 1 cut(s) 313
BstMBI GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
BstMCI CGRYCG 3 cut(s) 58, 67, 1005
BstMWI GCNNNNNNNGC 6 cut(s) 454, 509, 1046, 1230, 1239, 1319
BstNI CCWGG 3 cut(s) 73, 1045, 1299
BstNSI RCATGY 3 cut(s) 461, 659, 881
BstSCI CCNGG 7 cut(s) 71, 212, 435, 471, 715, 1043, 1297
BstSFI CTRYAG 1 cut(s) 343
BstUI CGCG 1 cut(s) 1001
BstV1I GCAGC 2 cut(s) 361, 886
BstX2I RGATCY 2 cut(s) 692, 724
BstXI CCANNNNNNTGG 1 cut(s) 594
BstYI RGATCY 2 cut(s) 692, 724
BstZ17I GTATAC 1 cut(s) 46
BstZI CGGCCG 1 cut(s) 1002
Bsu15I ATCGAT 1 cut(s) 102
Bsu36I CCTNAGG 1 cut(s) 987
BsuRI GGCC 7 cut(s) 395, 435, 1004, 1049, 1068, 1297, 1313
BsuTUI ATCGAT 1 cut(s) 102
BtsCI GGATG 4 cut(s) 95, 583, 787, 839
BtsI GCAGTG 2 cut(s) 292, 1164
BtsIMutI CAGTG 4 cut(s) 292, 817, 1164, 1354
Cac8I GCNNGC 4 cut(s) 459, 657, 962, 1059
CaiI CAGNNNCTG 2 cut(s) 92, 1125
CciI TCATGA 1 cut(s) 945
CfoI GCGC 2 cut(s) 497, 1001
Cfr10I RCCGGY 3 cut(s) 113, 431, 453
Cfr13I GGNCC 6 cut(s) 393, 434, 1047, 1295, 1301, 1311
ClaI ATCGAT 1 cut(s) 102
CseI GACGC 1 cut(s) 1085
CspAI ACCGGT 1 cut(s) 113
DdeI CTNAG 2 cut(s) 540, 987
DpnI GATC 8 cut(s) 38, 105, 694, 726, 893, 1022, 1116, 1213
DpnII GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
EaeI YGGCCR 1 cut(s) 1002
EagI CGGCCG 1 cut(s) 1002
Eam1104I CTCTTC 4 cut(s) 231, 372, 435, 821
EarI CTCTTC 4 cut(s) 231, 372, 435, 821
EciI GGCGGA 3 cut(s) 630, 1224, 1257
EclXI CGGCCG 1 cut(s) 1002
Eco47I GGWCC 1 cut(s) 1301
Eco47III AGCGCT 1 cut(s) 496
Eco52I CGGCCG 1 cut(s) 1002
Eco57I CTGAAG 1 cut(s) 333
Eco81I CCTNAGG 1 cut(s) 987
EcoRII CCWGG 3 cut(s) 71, 1043, 1297
FaqI GGGAC 2 cut(s) 74, 400
FauI CCCGC 2 cut(s) 711, 953
FauNDI CATATG 1 cut(s) 281
FbaI TGATCA 2 cut(s) 36, 891
FblI GTMKAC 1 cut(s) 45
Fnu4HI GCNGC 6 cut(s) 375, 396, 875, 1002, 1105, 1108
FokI GGATG 4 cut(s) 82, 570, 794, 846
Fsp4HI GCNGC 6 cut(s) 375, 396, 875, 1002, 1105, 1108
FspBI CTAG 4 cut(s) 14, 687, 900, 1053
GlaI GCGC 2 cut(s) 496, 1000
GluI GCNGC 6 cut(s) 375, 396, 875, 1002, 1105, 1108
GsaI CCCAGC 2 cut(s) 501, 1296
HaeII RGCGCY 1 cut(s) 498
HaeIII GGCC 7 cut(s) 395, 435, 1004, 1049, 1068, 1297, 1313
HgaI GACGC 1 cut(s) 1085
HhaI GCGC 2 cut(s) 497, 1001
Hin1I GRCGYC 2 cut(s) 132, 1077
Hin6I GCGC 2 cut(s) 495, 999
HinP1I GCGC 2 cut(s) 495, 999
HincII GTYRAC 2 cut(s) 210, 340
HindII GTYRAC 2 cut(s) 210, 340
HinfI GANTC 7 cut(s) 60, 197, 206, 386, 413, 637, 1198
HphI GGTGA 6 cut(s) 500, 506, 611, 1063, 1189, 1273
Hpy166II GTNNAC 4 cut(s) 46, 210, 235, 340
Hpy188I TCNGA 6 cut(s) 180, 313, 541, 697, 729, 995
Hpy188III TCNNGA 3 cut(s) 928, 946, 1172
Hpy8I GTNNAC 4 cut(s) 46, 210, 235, 340
Hpy99I CGWCG 3 cut(s) 11, 137, 1079
HpyAV CCTTC 3 cut(s) 262, 772, 1282
HpyCH4III ACNGT 3 cut(s) 56, 88, 812
HpyCH4IV ACGT 2 cut(s) 132, 1091
HpyCH4V TGCA 6 cut(s) 95, 258, 297, 583, 655, 1224
HpyF10VI GCNNNNNNNGC 6 cut(s) 454, 509, 1046, 1230, 1239, 1319
HpyF3I CTNAG 2 cut(s) 540, 987
HpySE526I ACGT 2 cut(s) 132, 1091
Hsp92I GRCGYC 2 cut(s) 132, 1077
HspAI GCGC 2 cut(s) 495, 999
Kpn2I TCCGGA 1 cut(s) 1171
Ksp22I TGATCA 2 cut(s) 36, 891
Kzo9I GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
LmnI GCTCC 5 cut(s) 225, 358, 871, 1174, 1244
Lsp1109I GCAGC 2 cut(s) 361, 886
LweI GCATC 4 cut(s) 104, 592, 772, 1254
MaeI CTAG 4 cut(s) 14, 687, 900, 1053
MaeII ACGT 2 cut(s) 132, 1091
MaeIII GTNAC 3 cut(s) 284, 905, 916
MalI GATC 8 cut(s) 38, 105, 694, 726, 893, 1022, 1116, 1213
MbiI CCGCTC 1 cut(s) 398
MboI GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
MboII GAAGA 8 cut(s) 218, 359, 395, 452, 614, 835, 838, 943
MflI RGATCY 2 cut(s) 692, 724
MhlI GDGCHC 1 cut(s) 363
MluCI AATT 3 cut(s) 545, 949, 1007
MlyI GAGTC 4 cut(s) 206, 215, 422, 646
MmeI TCCRAC 2 cut(s) 210, 973
MroI TCCGGA 1 cut(s) 1171
MseI TTAA 2 cut(s) 558, 711
MslI CAYNNNNRTG 3 cut(s) 246, 654, 1219
MspR9I CCNGG 7 cut(s) 73, 214, 437, 473, 717, 1045, 1299
MvaI CCWGG 3 cut(s) 73, 1045, 1299
MvnI CGCG 1 cut(s) 1001
MwoI GCNNNNNNNGC 6 cut(s) 454, 509, 1046, 1230, 1239, 1319
NciI CCSGG 4 cut(s) 214, 437, 473, 717
NdeI CATATG 1 cut(s) 281
NdeII GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
NlaIV GGNNCC 5 cut(s) 250, 354, 430, 726, 1303
NmeAIII GCCGAG 1 cut(s) 229
NmuCI GTSAC 3 cut(s) 284, 905, 916
NspI RCATGY 3 cut(s) 461, 659, 881
OliI CACNNNNGTG 1 cut(s) 246
PaeI GCATGC 2 cut(s) 461, 659
PagI TCATGA 1 cut(s) 945
PasI CCCWGGG 1 cut(s) 72
PcsI WCGNNNNNNNCGW 2 cut(s) 60, 64
PfeI GAWTC 3 cut(s) 60, 386, 1198
PflFI GACNNNGTC 2 cut(s) 134, 1305
PinAI ACCGGT 1 cut(s) 113
PkrI GCNGC 6 cut(s) 376, 397, 876, 1003, 1106, 1109
PleI GAGTC 4 cut(s) 205, 214, 421, 645
PpsI GAGTC 4 cut(s) 205, 214, 421, 645
Psp1406I AACGTT 1 cut(s) 1091
Psp6I CCWGG 3 cut(s) 71, 1043, 1297
PspFI CCCAGC 2 cut(s) 497, 1292
PspGI CCWGG 3 cut(s) 71, 1043, 1297
PspN4I GGNNCC 5 cut(s) 250, 354, 430, 726, 1303
PspPI GGNCC 6 cut(s) 393, 434, 1047, 1295, 1301, 1311
PstNI CAGNNNCTG 2 cut(s) 92, 1125
PsuI RGATCY 2 cut(s) 692, 724
PsyI GACNNNGTC 2 cut(s) 134, 1305
RseI CAYNNNNRTG 3 cut(s) 246, 654, 1219
SaqAI TTAA 2 cut(s) 558, 711
SatI GCNGC 6 cut(s) 375, 396, 875, 1002, 1105, 1108
Sau3AI GATC 8 cut(s) 36, 103, 692, 724, 891, 1020, 1114, 1211
Sau96I GGNCC 6 cut(s) 393, 434, 1047, 1295, 1301, 1311
SchI GAGTC 4 cut(s) 206, 215, 422, 646
ScrFI CCNGG 7 cut(s) 73, 214, 437, 473, 717, 1045, 1299
SduI GDGCHC 1 cut(s) 363
SfaNI GCATC 4 cut(s) 104, 592, 772, 1254
SfcI CTRYAG 1 cut(s) 343
SinI GGWCC 1 cut(s) 1301
SmiMI CAYNNNNRTG 3 cut(s) 246, 654, 1219
SmlI CTYRAG 1 cut(s) 926
SmoI CTYRAG 1 cut(s) 926
SpeI ACTAGT 1 cut(s) 686
SphI GCATGC 2 cut(s) 461, 659
Sse9I AATT 3 cut(s) 545, 949, 1007
SspMI CTAG 4 cut(s) 14, 687, 900, 1053
StyD4I CCNGG 7 cut(s) 71, 212, 435, 471, 715, 1043, 1297
TaaI ACNGT 3 cut(s) 56, 88, 812
TaiI ACGT 2 cut(s) 135, 1094
TaqI TCGA 3 cut(s) 58, 63, 102
TaqII GACCGA 1 cut(s) 81
TasI AATT 3 cut(s) 545, 949, 1007
TauI GCSGC 4 cut(s) 398, 1004, 1107, 1110
TfiI GAWTC 3 cut(s) 60, 386, 1198
Tru1I TTAA 2 cut(s) 558, 711
Tru9I TTAA 2 cut(s) 558, 711
TscAI CASTG 3 cut(s) 299, 817, 1171
TseFI GTSAC 3 cut(s) 284, 905, 916
TseI GCWGC 2 cut(s) 374, 874
Tsp45I GTSAC 3 cut(s) 284, 905, 916
TspDTI ATGAA 4 cut(s) 378, 396, 934, 962
TspRI CASTG 3 cut(s) 299, 817, 1171
Tth111I GACNNNGTC 2 cut(s) 134, 1305
VpaK11BI GGWCC 1 cut(s) 1301
XceI RCATGY 3 cut(s) 461, 659, 881
XmiI GTMKAC 1 cut(s) 45
XspI CTAG 4 cut(s) 14, 687, 900, 1053
ZraI GACGTC 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.