RLG00000027654

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0000653
Physical Location & Seq
Forward (+)
13593675 .. 13599813
6139 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000027654

Sequence Viewer

Length: 765 bp
ATGGACGCGGGTCTGGATCTGGCCGGCAAGGAAAGGACTGATGGTAGAAAGGGGGAACAATCAAAGGATGCTCAAGGCCGTGACAAATTTGTTCAAACACCGGGGGGATCACTAGCTGGGAAAATCCCTTTTGTTGTTGACAAATCACTGAATATTGCTCGGGAAGAATCTGAAAAGTATATCCATTTGCTGTATGCTATGCAAAAGCTTAGTGTCCAGATGAAGCTGCTGGGTTTTGGCAATTTCACTAACAAGAGGACTCATGGTAGCAAGGGGGGAGAATTAGAGGGTCCTGGTTATTACAATTTGGGGAATTTTCTTTGCGATCTCACACATTTCGTGGCAAAAGTGGGTTTTGATTTTGATTTGGTTTCCATTGATAGTGATTCCGTTTATCGGAAGATGCTGAATGATGAGACCGCGACTCATGTAATGGAATGGGAACCTATGGGATCGGATCTCTTGGATGATCGAGTTGAGAAGAAGCTGCGGGAATATTTCAAATTACTGGAGGACAAGGGATGTTCTTCCTCGGATATGGATGTGGCTGACAAGAACAGGACTCAAGGACAAAGCAATAATATCAAGGACGAAGAATCTGAGGACAATGAATCTGAGGACCAGGAAACTGAGGACGAGGATCCGAATCTGGCTGTTGAGAACGGCTGCGATGGTGAAAAATTATTAGGTCAGATGAAAACAAATGATGCTGGAGTGTTATCTCCGTATGGGCGACTATGTGTTTGTGCATGTGAAAGACTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

255

Amino Acids

28.27

Weight (kDa)

4.67

Isoelectric Point (pI)

30.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 8, 422
AciI CCGC 3 cut(s) 8, 420, 490
AclWI GGATC 6 cut(s) 24, 115, 460, 465, 635, 648
AcoI YGGCCR 1 cut(s) 21
AcsI RAATTY 2 cut(s) 86, 313
AfiI CCNNNNNNNGG 1 cut(s) 396
AgsI TTSAA 2 cut(s) 95, 502
AjnI CCWGG 2 cut(s) 292, 621
AluBI AGCT 4 cut(s) 116, 208, 226, 487
AluI AGCT 4 cut(s) 116, 208, 226, 487
Alw26I GTCTC 1 cut(s) 410
AlwI GGATC 6 cut(s) 24, 115, 460, 465, 635, 648
Ama87I CYCGRG 1 cut(s) 159
AoxI GGCC 2 cut(s) 21, 76
ApeKI GCWGC 3 cut(s) 226, 487, 666
ApoI RAATTY 2 cut(s) 86, 313
ArsI GACNNNNNNTTYG 2 cut(s) 726, 758
AspS9I GGNCC 2 cut(s) 290, 619
AsuC2I CCSGG 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 686
AvaI CYCGRG 1 cut(s) 159
AvaII GGWCC 2 cut(s) 290, 619
BamHI GGATCC 1 cut(s) 640
BbvI GCAGC 3 cut(s) 213, 474, 653
BccI CCATC 2 cut(s) 35, 665
BceAI ACGGC 2 cut(s) 63, 679
BciT130I CCWGG 2 cut(s) 294, 623
BcnI CCSGG 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 410
BfaI CTAG 1 cut(s) 113
BisI GCNGC 3 cut(s) 227, 488, 667
BlsI GCNGC 3 cut(s) 228, 489, 668
Bme1390I CCNGG 3 cut(s) 102, 294, 623
Bme18I GGWCC 2 cut(s) 290, 619
BmeT110I CYCGRG 1 cut(s) 159
BmgT120I GGNCC 2 cut(s) 290, 619
BmiI GGNNCC 3 cut(s) 291, 444, 642
BmrFI CCNGG 3 cut(s) 102, 294, 623
BmsI GCATC 3 cut(s) 58, 393, 697
BoxI GACNNNNGTC 1 cut(s) 9
BpmI CTGGAG 2 cut(s) 530, 732
BpuEI CTTGAG 2 cut(s) 57, 549
BpuMI CCSGG 1 cut(s) 102
BsaBI GATNNNNATC 1 cut(s) 645
BsaI GGTCTC 1 cut(s) 410
BsaJI CCNNGG 2 cut(s) 101, 531
Bsc4I CCNNNNNNNGG 1 cut(s) 396
Bse118I RCCGGY 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 513
Bse8I GATNNNNATC 1 cut(s) 645
BseBI CCWGG 2 cut(s) 294, 623
BseDI CCNNGG 2 cut(s) 101, 531
BseGI GGATG 4 cut(s) 73, 472, 527, 547
BseJI GATNNNNATC 1 cut(s) 645
BseLI CCNNNNNNNGG 1 cut(s) 396
BseMII CTCAG 3 cut(s) 591, 606, 621
BseNI ACTGG 1 cut(s) 513
BseXI GCAGC 3 cut(s) 213, 474, 653
BseYI CCCAGC 2 cut(s) 116, 229
Bsh1236I CGCG 2 cut(s) 8, 422
BshFI GGCC 2 cut(s) 23, 78
BsiHKCI CYCGRG 1 cut(s) 159
BsiSI CCGG 2 cut(s) 24, 101
BslI CCNNNNNNNGG 1 cut(s) 396
BsmAI GTCTC 1 cut(s) 410
BsnI GGCC 2 cut(s) 23, 78
Bso31I GGTCTC 1 cut(s) 410
BsoBI CYCGRG 1 cut(s) 159
Bsp143I GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
BspACI CCGC 3 cut(s) 8, 420, 490
BspANI GGCC 2 cut(s) 23, 78
BspCNI CTCAG 3 cut(s) 592, 607, 622
BspFNI CGCG 2 cut(s) 8, 422
BspLI GGNNCC 3 cut(s) 291, 444, 642
BspPI GGATC 6 cut(s) 24, 115, 460, 465, 635, 648
BspTNI GGTCTC 1 cut(s) 410
BsrFI RCCGGY 1 cut(s) 23
BsrI ACTGG 1 cut(s) 513
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 2 cut(s) 101, 531
BssMI GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
Bst2UI CCWGG 2 cut(s) 294, 623
BstC8I GCNNGC 1 cut(s) 25
BstDEI CTNAG 4 cut(s) 209, 600, 615, 630
BstF5I GGATG 4 cut(s) 73, 472, 527, 547
BstFNI CGCG 2 cut(s) 8, 422
BstKTI GATC 7 cut(s) 19, 110, 328, 455, 460, 472, 643
BstMAI GTCTC 1 cut(s) 410
BstMBI GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
BstNI CCWGG 2 cut(s) 294, 623
BstNSI RCATGY 1 cut(s) 753
BstPAI GACNNNNGTC 1 cut(s) 9
BstSCI CCNGG 3 cut(s) 100, 292, 621
BstUI CGCG 2 cut(s) 8, 422
BstV1I GCAGC 3 cut(s) 213, 474, 653
BstX2I RGATCY 3 cut(s) 16, 457, 640
BstYI RGATCY 3 cut(s) 16, 457, 640
BsuRI GGCC 2 cut(s) 23, 78
BtgZI GCGATG 1 cut(s) 684
BtsCI GGATG 4 cut(s) 73, 472, 527, 547
BtsIMutI CAGTG 1 cut(s) 146
Cac8I GCNNGC 1 cut(s) 25
Cfr10I RCCGGY 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 290, 619
CseI GACGC 1 cut(s) 14
CviAII CATG 3 cut(s) 263, 428, 750
CviJI RGCY 9 cut(s) 23, 78, 116, 208, 226, 487, 548, 653, 666
CviKI_1 RGCY 9 cut(s) 23, 78, 116, 208, 226, 487, 548, 653, 666
DdeI CTNAG 4 cut(s) 209, 600, 615, 630
DpnI GATC 7 cut(s) 18, 109, 327, 454, 459, 471, 642
DpnII GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
EaeI YGGCCR 1 cut(s) 21
Eco31I GGTCTC 1 cut(s) 410
Eco47I GGWCC 2 cut(s) 290, 619
Eco88I CYCGRG 1 cut(s) 159
EcoO109I RGGNCCY 1 cut(s) 290
EcoRII CCWGG 2 cut(s) 292, 621
FaeI CATG 3 cut(s) 266, 431, 753
FatI CATG 3 cut(s) 262, 427, 749
FauI CCCGC 1 cut(s) 483
Fnu4HI GCNGC 3 cut(s) 227, 488, 667
FokI GGATG 4 cut(s) 80, 479, 534, 554
Fsp4HI GCNGC 3 cut(s) 227, 488, 667
FspBI CTAG 1 cut(s) 113
GluI GCNGC 3 cut(s) 227, 488, 667
GsaI CCCAGC 2 cut(s) 120, 233
GsuI CTGGAG 2 cut(s) 530, 732
HaeIII GGCC 2 cut(s) 23, 78
HapII CCGG 2 cut(s) 24, 101
HgaI GACGC 1 cut(s) 14
Hin1II CATG 3 cut(s) 266, 431, 753
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 206
HinfI GANTC 9 cut(s) 167, 259, 386, 424, 562, 596, 611, 646, 759
HpaII CCGG 2 cut(s) 24, 101
HphI GGTGA 1 cut(s) 686
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 8 cut(s) 172, 399, 457, 535, 601, 616, 645, 693
Hpy188III TCNNGA 3 cut(s) 14, 161, 217
Hpy8I GTNNAC 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 202, 749
HpyF3I CTNAG 4 cut(s) 209, 600, 615, 630
Hsp92II CATG 3 cut(s) 266, 431, 753
KroI GCCGGC 1 cut(s) 23
KroNI GCCGGC 1 cut(s) 25
Kzo9I GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
Lsp1109I GCAGC 3 cut(s) 213, 474, 653
LweI GCATC 3 cut(s) 58, 393, 697
MaeI CTAG 1 cut(s) 113
MaeIII GTNAC 1 cut(s) 80
MalI GATC 7 cut(s) 18, 109, 327, 454, 459, 471, 642
MboI GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
MboII GAAGA 5 cut(s) 176, 412, 493, 519, 605
MflI RGATCY 3 cut(s) 16, 457, 640
MluCI AATT 7 cut(s) 86, 241, 281, 304, 313, 503, 680
MlyI GAGTC 4 cut(s) 253, 418, 556, 753
MnlI CCTC 8 cut(s) 249, 280, 505, 541, 595, 610, 625, 631
MroNI GCCGGC 1 cut(s) 23
MspI CCGG 2 cut(s) 24, 101
MspR9I CCNGG 3 cut(s) 102, 294, 623
MvaI CCWGG 2 cut(s) 294, 623
MvnI CGCG 2 cut(s) 8, 422
NaeI GCCGGC 1 cut(s) 25
NciI CCSGG 1 cut(s) 102
NdeII GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
NgoMIV GCCGGC 1 cut(s) 23
NlaIII CATG 3 cut(s) 266, 431, 753
NlaIV GGNNCC 3 cut(s) 291, 444, 642
NmuCI GTSAC 1 cut(s) 80
NspI RCATGY 1 cut(s) 753
PdiI GCCGGC 1 cut(s) 25
PfeI GAWTC 5 cut(s) 167, 386, 596, 611, 646
PkrI GCNGC 3 cut(s) 228, 489, 668
PleI GAGTC 4 cut(s) 253, 418, 556, 753
PpsI GAGTC 4 cut(s) 253, 418, 556, 753
PpuMI RGGWCCY 1 cut(s) 290
PshAI GACNNNNGTC 1 cut(s) 9
Psp5II RGGWCCY 1 cut(s) 290
Psp6I CCWGG 2 cut(s) 292, 621
PspFI CCCAGC 2 cut(s) 116, 229
PspGI CCWGG 2 cut(s) 292, 621
PspN4I GGNNCC 3 cut(s) 291, 444, 642
PspPI GGNCC 2 cut(s) 290, 619
PspPPI RGGWCCY 1 cut(s) 290
PsuI RGATCY 3 cut(s) 16, 457, 640
SatI GCNGC 3 cut(s) 227, 488, 667
Sau3AI GATC 7 cut(s) 16, 107, 325, 452, 457, 469, 640
Sau96I GGNCC 2 cut(s) 290, 619
SchI GAGTC 4 cut(s) 253, 418, 556, 753
ScrFI CCNGG 3 cut(s) 102, 294, 623
SetI ASST 6 cut(s) 118, 210, 228, 448, 489, 691
SfaNI GCATC 3 cut(s) 58, 393, 697
SinI GGWCC 2 cut(s) 290, 619
SmlI CTYRAG 2 cut(s) 72, 564
SmoI CTYRAG 2 cut(s) 72, 564
Sse9I AATT 7 cut(s) 86, 241, 281, 304, 313, 503, 680
SsiI CCGC 3 cut(s) 8, 420, 490
SspI AATATT 2 cut(s) 154, 497
SspMI CTAG 1 cut(s) 113
StyD4I CCNGG 3 cut(s) 100, 292, 621
TaqI TCGA 1 cut(s) 472
TasI AATT 7 cut(s) 86, 241, 281, 304, 313, 503, 680
TfiI GAWTC 5 cut(s) 167, 386, 596, 611, 646
TscAI CASTG 1 cut(s) 153
TseFI GTSAC 1 cut(s) 80
TseI GCWGC 3 cut(s) 226, 487, 666
Tsp45I GTSAC 1 cut(s) 80
TspDTI ATGAA 3 cut(s) 236, 624, 710
TspGWI ACGGA 2 cut(s) 379, 714
TspRI CASTG 1 cut(s) 153
VpaK11BI GGWCC 2 cut(s) 290, 619
XapI RAATTY 2 cut(s) 86, 313
XceI RCATGY 1 cut(s) 753
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.