Rh2BG476500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0000653
Physical Location & Seq
Reverse (-)
67153397 .. 67154273
877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG476500.1

Sequence Viewer

Length: 264 bp
ATGGAGAAGAACAAACATCTAAAATTTTGCTGTAACCTCAAAACAGGTAGCAAGGGGAAAGAATCAAAGGATCATCTAAAATTTGCCCGTGATGACTTTTTGGGCATAAATATTCCAGGATATGCTAAGCTGAAGAGTTGTGCTTATTGTTTCTCTATTGGTCACTGGGAGTGGGAGGACTGTGAAGATTGTCCTAGACCCAAGGACGTCGTCTTTGAGAAAGATGAATACTTAGATGGGGATGGGATTTCCTCAGACTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.0

Weight (kDa)

5.54

Isoelectric Point (pI)

22.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 210
AclWI GGATC 1 cut(s) 78
AcsI RAATTY 2 cut(s) 23, 80
AcuI CTGAAG 1 cut(s) 152
AcyI GRCGYC 1 cut(s) 207
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
AlwI GGATC 1 cut(s) 78
ApoI RAATTY 2 cut(s) 23, 80
ArsI GACNNNNNNTTYG 2 cut(s) 197, 229
BccI CCATC 2 cut(s) 230, 236
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 195
BlpI GCTNAGC 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 117
BmrI ACTGGG 1 cut(s) 175
BmuI ACTGGG 1 cut(s) 175
Bpu1102I GCTNAGC 1 cut(s) 126
BsaHI GRCGYC 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 201
Bse1I ACTGG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 247
BseNI ACTGG 1 cut(s) 170
Bsp143I GATC 1 cut(s) 70
Bsp1720I GCTNAGC 1 cut(s) 126
BspPI GGATC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 1 cut(s) 70
BssNI GRCGYC 1 cut(s) 207
BssT1I CCWWGG 1 cut(s) 201
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 1 cut(s) 182
Bst6I CTCTTC 1 cut(s) 128
BstACI GRCGYC 1 cut(s) 207
BstDEI CTNAG 3 cut(s) 126, 232, 253
BstF5I GGATG 1 cut(s) 247
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 163
CviJI RGCY 1 cut(s) 130
CviKI_1 RGCY 1 cut(s) 130
DdeI CTNAG 3 cut(s) 126, 232, 253
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
Eco130I CCWWGG 1 cut(s) 201
Eco57I CTGAAG 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 201
ErhI CCWWGG 1 cut(s) 201
FaiI YATR 3 cut(s) 107, 123, 262
FokI GGATG 1 cut(s) 254
FspBI CTAG 1 cut(s) 195
Hin1I GRCGYC 1 cut(s) 207
HinfI GANTC 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 256
Hpy99I CGWCG 1 cut(s) 212
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 207
HpyF3I CTNAG 3 cut(s) 126, 232, 253
HpySE526I ACGT 1 cut(s) 207
Hsp92I GRCGYC 1 cut(s) 207
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 30, 102, 129, 151
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 207
MaeIII GTNAC 2 cut(s) 32, 161
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 19, 145, 197
MluCI AATT 2 cut(s) 23, 80
MnlI CCTC 3 cut(s) 47, 169, 262
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
NdeII GATC 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 62
PflFI GACNNNGTC 1 cut(s) 209
PfoI TCCNGGA 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PsyI GACNNNGTC 1 cut(s) 209
Sau3AI GATC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 117
SetI ASST 4 cut(s) 39, 49, 132, 210
SgeI CNNG 9 cut(s) 57, 64, 99, 101, 128, 129, 178, 207, 214
Sse9I AATT 2 cut(s) 23, 80
SspI AATATT 1 cut(s) 112
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 182
TaiI ACGT 1 cut(s) 210
TasI AATT 2 cut(s) 23, 80
TfiI GAWTC 1 cut(s) 62
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 240
TspRI CASTG 1 cut(s) 170
Tth111I GACNNNGTC 1 cut(s) 209
XapI RAATTY 2 cut(s) 23, 80
XspI CTAG 1 cut(s) 195
ZraI GACGTC 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.