Rh6DG174400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
30640356 .. 30640628
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG174400.1

Sequence Viewer

Length: 273 bp
ATGGATGAGAATCACTATGATTCGGACTGCCCATGGCTAGATAAATTGCCACCAGACCAAACTATTGTTGGCCCTTACTATGACATAGTTTGCATCGGCTATGGCCAGATTGGTGAGCTGTGCTGTTCCAAGAGAGGTTCCAAGAGAGGATATGCTGTTCTCAAGTCCTGTATATATTGTCATTCAGCTAGTCACTGGCCTTGGGAATGCCTCACTGGCCCCAAGATTCTGGGGCTCACGGAGGAGCTCATCGAGGAAGTCATATCCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.13

Weight (kDa)

4.79

Isoelectric Point (pI)

59.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 103
AloI GAACNNNNNNTCC 2 cut(s) 141, 173
AluBI AGCT 3 cut(s) 118, 188, 247
AluI AGCT 3 cut(s) 118, 188, 247
Alw21I GWGCWC 1 cut(s) 249
AoxI GGCC 4 cut(s) 70, 103, 197, 217
AspS9I GGNCC 2 cut(s) 71, 218
AsuHPI GGTGA 1 cut(s) 125
BalI TGGCCA 1 cut(s) 105
BanII GRGCYC 2 cut(s) 237, 249
Bbv12I GWGCWC 1 cut(s) 249
BfaI CTAG 2 cut(s) 38, 189
BglI GCCNNNNNGGC 1 cut(s) 216
BmgT120I GGNCC 2 cut(s) 71, 218
BmiI GGNNCC 2 cut(s) 139, 220
BmsI GCATC 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 146
BsaBI GATNNNNATC 1 cut(s) 9
BsaJI CCNNGG 2 cut(s) 32, 200
Bse1I ACTGG 2 cut(s) 200, 220
Bse8I GATNNNNATC 1 cut(s) 9
BseDI CCNNGG 2 cut(s) 32, 200
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 9
BseNI ACTGG 2 cut(s) 200, 220
BseRI GAGGAG 1 cut(s) 257
BshFI GGCC 4 cut(s) 72, 105, 199, 219
BsiHKAI GWGCWC 1 cut(s) 249
BsmI GAATGC 1 cut(s) 212
BsnI GGCC 4 cut(s) 72, 105, 199, 219
Bsp1286I GDGCHC 2 cut(s) 237, 249
Bsp19I CCATGG 1 cut(s) 32
BspANI GGCC 4 cut(s) 72, 105, 199, 219
BspLI GGNNCC 2 cut(s) 139, 220
BsrI ACTGG 2 cut(s) 200, 220
BssECI CCNNGG 2 cut(s) 32, 200
BssT1I CCWWGG 2 cut(s) 32, 200
BstDSI CCRYGG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstXI CCANNNNNNTGG 1 cut(s) 229
BsuRI GGCC 4 cut(s) 72, 105, 199, 219
BtgI CCRYGG 1 cut(s) 32
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 193, 213
Cfr13I GGNCC 2 cut(s) 71, 218
CviAII CATG 1 cut(s) 33
EaeI YGGCCR 1 cut(s) 103
Ecl136II GAGCTC 1 cut(s) 247
Eco130I CCWWGG 2 cut(s) 32, 200
Eco24I GRGCYC 2 cut(s) 237, 249
Eco53kI GAGCTC 1 cut(s) 247
EcoICRI GAGCTC 1 cut(s) 247
EcoT14I CCWWGG 2 cut(s) 32, 200
EcoT38I GRGCYC 2 cut(s) 237, 249
ErhI CCWWGG 2 cut(s) 32, 200
FaeI CATG 1 cut(s) 36
FaiI YATR 9 cut(s) 18, 34, 81, 86, 102, 153, 173, 175, 263
FatI CATG 1 cut(s) 32
FokI GGATG 1 cut(s) 17
FriOI GRGCYC 2 cut(s) 237, 249
FspBI CTAG 2 cut(s) 38, 189
HaeIII GGCC 4 cut(s) 72, 105, 199, 219
Hin1II CATG 1 cut(s) 36
HinfI GANTC 3 cut(s) 10, 20, 226
HphI GGTGA 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 270
HpyCH4V TGCA 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
Hsp92II CATG 1 cut(s) 36
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 6 cut(s) 66, 119, 181, 181, 201, 215
LweI GCATC 1 cut(s) 102
MaeI CTAG 2 cut(s) 38, 189
MaeIII GTNAC 1 cut(s) 191
MhlI GDGCHC 2 cut(s) 237, 249
MlsI TGGCCA 1 cut(s) 105
MluCI AATT 1 cut(s) 44
MluNI TGGCCA 1 cut(s) 105
MnlI CCTC 5 cut(s) 128, 140, 221, 235, 247
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 105
Mva1269I GAATGC 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 216
NcoI CCATGG 1 cut(s) 32
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 2 cut(s) 139, 220
NmuCI GTSAC 1 cut(s) 191
PctI GAATGC 1 cut(s) 212
PfeI GAWTC 3 cut(s) 10, 20, 226
Psp124BI GAGCTC 1 cut(s) 249
PspN4I GGNNCC 2 cut(s) 139, 220
PspPI GGNCC 2 cut(s) 71, 218
SacI GAGCTC 1 cut(s) 249
Sau96I GGNCC 2 cut(s) 71, 218
SduI GDGCHC 2 cut(s) 237, 249
SetI ASST 4 cut(s) 120, 139, 190, 249
SfaNI GCATC 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 1 cut(s) 44
SspMI CTAG 2 cut(s) 38, 189
SstI GAGCTC 1 cut(s) 249
StyI CCWWGG 2 cut(s) 32, 200
TaqI TCGA 1 cut(s) 252
TasI AATT 1 cut(s) 44
TfiI GAWTC 3 cut(s) 10, 20, 226
TscAI CASTG 2 cut(s) 200, 220
TseFI GTSAC 1 cut(s) 191
Tsp45I GTSAC 1 cut(s) 191
TspGWI ACGGA 1 cut(s) 254
TspRI CASTG 2 cut(s) 200, 220
XcmI CCANNNNNNNNNTGG 1 cut(s) 65
XspI CTAG 2 cut(s) 38, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.