Rh1BG263900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0000653
Physical Location & Seq
Reverse (-)
39839782 .. 39840099
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG263900.1

Sequence Viewer

Length: 318 bp
ATGGAATTAGTTGAATATTACGTGTATGTGAAAGACGCTAAAAAGGAAGAAAACAGAGAAGATAGAGATGGTGGAGCCGGAGGAGAAGGCTGTCCCATTTGTGGTAACCTTGATCACTTTAACTCACAATGTCCATGGCTAGAAAATGTTCCACCAGGCGAACAAGTTGGCCCTCTCTATGACCCTAGTTGTGGTAAGTTGGGACTTGCATGCTGTTCTGAGGACGACGTGCTGTCCTCAAGCGGTGTGGTCATTGTTATGATTTTGGTCATTAGTGGGAGGCCTGCCCCAACTACAAATATGCCCCTTACCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.28

Weight (kDa)

4.4

Isoelectric Point (pI)

48.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 243
AfiI CCNNNNNNNGG 2 cut(s) 101, 191
AflIII ACRYGT 1 cut(s) 21
AgsI TTSAA 1 cut(s) 14
AhdI GACNNNNNGTC 1 cut(s) 232
AjiI CACGTC 1 cut(s) 229
AjnI CCWGG 1 cut(s) 154
AoxI GGCC 2 cut(s) 169, 281
Asp700I GAANNNNTTC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 170
BccI CCATC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 156
BclI TGATCA 1 cut(s) 112
BfaI CTAG 2 cut(s) 140, 186
Bme1390I CCNGG 1 cut(s) 156
BmeRI GACNNNNNGTC 1 cut(s) 232
BmgBI CACGTC 1 cut(s) 229
BmgT120I GGNCC 1 cut(s) 170
BmiI GGNNCC 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 223
BsaAI YACGTR 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 2 cut(s) 101, 191
BseBI CCWGG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 134
BseLI CCNNNNNNNGG 2 cut(s) 101, 191
BseMII CTCAG 1 cut(s) 210
BseRI GAGGAG 1 cut(s) 96
BshFI GGCC 2 cut(s) 171, 283
BsiSI CCGG 1 cut(s) 78
BslFI GGGAC 2 cut(s) 78, 216
BslI CCNNNNNNNGG 2 cut(s) 101, 191
BsmFI GGGAC 2 cut(s) 78, 216
BsnI GGCC 2 cut(s) 171, 283
Bsp143I GATC 1 cut(s) 112
Bsp19I CCATGG 1 cut(s) 134
BspACI CCGC 1 cut(s) 243
BspANI GGCC 2 cut(s) 171, 283
BspCNI CTCAG 1 cut(s) 211
BspLI GGNNCC 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 134
Bst2UI CCWGG 1 cut(s) 156
BstBAI YACGTR 1 cut(s) 22
BstC8I GCNNGC 2 cut(s) 211, 285
BstDEI CTNAG 1 cut(s) 219
BstDSI CCRYGG 1 cut(s) 134
BstEII GGTNACC 1 cut(s) 104
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 156
BstNSI RCATGY 1 cut(s) 213
BstPI GGTNACC 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 154
BsuRI GGCC 2 cut(s) 171, 283
BtgI CCRYGG 1 cut(s) 134
BtrI CACGTC 1 cut(s) 229
Cac8I GCNNGC 2 cut(s) 211, 285
Cfr13I GGNCC 1 cut(s) 170
CseI GACGC 1 cut(s) 44
CspCI CAANNNNNGTGG 2 cut(s) 228, 263
CviAII CATG 2 cut(s) 135, 210
CviJI RGCY 5 cut(s) 77, 90, 139, 171, 283
CviKI_1 RGCY 5 cut(s) 77, 90, 139, 171, 283
DdeI CTNAG 1 cut(s) 219
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
DriI GACNNNNNGTC 1 cut(s) 232
Eam1105I GACNNNNNGTC 1 cut(s) 232
Eco130I CCWWGG 1 cut(s) 134
Eco147I AGGCCT 1 cut(s) 283
Eco91I GGTNACC 1 cut(s) 104
EcoO65I GGTNACC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 134
FaeI CATG 2 cut(s) 138, 213
FaiI YATR 6 cut(s) 27, 136, 180, 211, 260, 302
FaqI GGGAC 2 cut(s) 78, 216
FatI CATG 2 cut(s) 134, 209
FbaI TGATCA 1 cut(s) 112
FspBI CTAG 2 cut(s) 140, 186
HaeIII GGCC 2 cut(s) 171, 283
HapII CCGG 1 cut(s) 78
HgaI GACGC 1 cut(s) 44
Hin1II CATG 2 cut(s) 138, 213
HpaII CCGG 1 cut(s) 78
Hpy188I TCNGA 1 cut(s) 220
Hpy99I CGWCG 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 80
HpyCH4IV ACGT 2 cut(s) 21, 228
HpyCH4V TGCA 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 219
HpySE526I ACGT 2 cut(s) 21, 228
Hsp92II CATG 2 cut(s) 138, 213
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 4 cut(s) 91, 141, 168, 297
MaeI CTAG 2 cut(s) 140, 186
MaeII ACGT 2 cut(s) 21, 228
MaeIII GTNAC 1 cut(s) 104
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 59, 71
MluCI AATT 1 cut(s) 5
MnlI CCTC 5 cut(s) 74, 183, 214, 247, 273
MroXI GAANNNNTTC 1 cut(s) 147
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 1 cut(s) 257
MspI CCGG 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NcoI CCATGG 1 cut(s) 134
NdeII GATC 1 cut(s) 112
NlaIII CATG 2 cut(s) 138, 213
NlaIV GGNNCC 1 cut(s) 76
NspI RCATGY 1 cut(s) 213
PaeI GCATGC 1 cut(s) 213
PceI AGGCCT 1 cut(s) 283
PdmI GAANNNNTTC 1 cut(s) 147
Ppu21I YACGTR 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 154
PspEI GGTNACC 1 cut(s) 104
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 170
RseI CAYNNNNRTG 1 cut(s) 257
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 156
SetI ASST 3 cut(s) 24, 111, 231
SmiMI CAYNNNNRTG 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 238
SmoI CTYRAG 1 cut(s) 238
SphI GCATGC 1 cut(s) 213
Sse9I AATT 1 cut(s) 5
SseBI AGGCCT 1 cut(s) 283
SsiI CCGC 1 cut(s) 243
SspI AATATT 1 cut(s) 17
SspMI CTAG 2 cut(s) 140, 186
StuI AGGCCT 1 cut(s) 283
StyD4I CCNGG 1 cut(s) 154
StyI CCWWGG 1 cut(s) 134
TaiI ACGT 2 cut(s) 24, 231
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
XceI RCATGY 1 cut(s) 213
XmnI GAANNNNTTC 1 cut(s) 147
XspI CTAG 2 cut(s) 140, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.