Rmu_co8254047.1_g000001

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8254047.1
OG0000545
Physical Location & Seq
Reverse (-)
1 .. 296
296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8254047.1_g000001.1.cds

Sequence Viewer

Length: 174 bp
atggttgcggagtcggttgcccttgacgtgatcaacaaggaaactgttgatctggagaatgtttccctgaaagaagtttttgaccatcttaaatgcacaaaagatggtttaagctctgatgaagttaaagagcggttggattcatttggttacaataagcttgaagaaaagaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

58

Amino Acids

6.59

Weight (kDa)

4.7

Isoelectric Point (pI)

32.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000545)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g36571
pyrus_communis pycom02g01560 pycom08g10820 pycom09g05820 pycom13g21850 pycom14g16010
rosa_chinensis RchiOBHm_Chr2g0094861 RchiOBHm_Chr2g0124911 RchiOBHm_Chr2g0138581 RchiOBHm_Chr2g0160851 RchiOBHm_Chr4g0407411
rosa_laevigata RLG00000001652 RLG00000001872 RLG00000002037 RLG00000003076 RLG00000006419 RLG00000016771 RLG00000017383 RLG00000022851 RLG00000030563 RLG00000033869 RLG00000034176
rosa_multiflora Rmu_co8013424.1_g000001 Rmu_co8016716.1_g000001 Rmu_co8183472.1_g000001 Rmu_co8254047.1_g000001 Rmu_co8354891.1_g000001 Rmu_sc0000124.1_g000003 Rmu_sc0002132.1_g000027 Rmu_sc0003007.1_g000011 Rmu_sc0003221.1_g000096 Rmu_sc0003221.1_g000097 Rmu_sc0005119.1_g000004 Rmu_sc0008057.1_g000005 Rmu_sc0034532.1_g000001 Rmu_sc0036406.1_g000001 Rmu_ssc0000008.1_g000009
rosa_roxburghii Rroxscaffold_1G00030520 Rroxscaffold_2G00107360 Rroxscaffold_2G00153420 Rroxscaffold_5G00335750 Rroxscaffold_5G00351760 Rroxscaffold_5G00352080 Rroxscaffold_6G00419090
rosa_rugosa Rorug01G0341800 Rorug01G0341900 Rorug02G0180200 Rorug02G0180300 Rorug03G0186100 Rorug03G0186200 Rorug03G0284800 Rorug04G0104500 Rorug05G0246300 Rorug06G0108400 Rorug06G0471500 Rorug06G0510400
rosa_samantha Rh1AG159000 Rh1CG148200 Rh1CG189900 Rh2AG552800 Rh2BG473900 Rh2BG612100 Rh2BG612300 Rh2DG094500 Rh2DG482600 Rh3BG234000 Rh3CG320000 Rh4AG144200 Rh4BG127900 Rh4DG097300 Rh5AG128900 Rh5AG381200 Rh5BG363000 Rh5DG491900 Rh6AG048400 Rh6BG168100 Rh6CG005800 Rh6DG006000 Rh7AG255100 Rh7BG360600 Rh7CG271700 Rh7CG482300 Rh7DG451200
rosa_wichuraiana Rw4G004970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 133
AciI CCGC 2 cut(s) 8, 133
AgsI TTSAA 1 cut(s) 164
AjiI CACGTC 1 cut(s) 28
AluBI AGCT 2 cut(s) 114, 160
AluI AGCT 2 cut(s) 114, 160
BccI CCATC 2 cut(s) 93, 98
BclI TGATCA 1 cut(s) 30
BmgBI CACGTC 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 74
Bsp143I GATC 2 cut(s) 30, 49
BspACI CCGC 2 cut(s) 8, 133
BsrBI CCGCTC 1 cut(s) 133
BssMI GATC 2 cut(s) 30, 49
Bst4CI ACNGT 1 cut(s) 46
BstKTI GATC 2 cut(s) 33, 52
BstMBI GATC 2 cut(s) 30, 49
BtrI CACGTC 1 cut(s) 28
CviJI RGCY 2 cut(s) 114, 160
CviKI_1 RGCY 2 cut(s) 114, 160
DpnI GATC 2 cut(s) 32, 51
DpnII GATC 2 cut(s) 30, 49
FbaI TGATCA 1 cut(s) 30
GsuI CTGGAG 1 cut(s) 74
HindIII AAGCTT 1 cut(s) 158
HinfI GANTC 2 cut(s) 11, 140
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 96
HpySE526I ACGT 1 cut(s) 27
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 30, 49
LpnPI CCDG 2 cut(s) 38, 80
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 149
MalI GATC 2 cut(s) 32, 51
MbiI CCGCTC 1 cut(s) 133
MboI GATC 2 cut(s) 30, 49
MlyI GAGTC 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 117
MseI TTAA 3 cut(s) 90, 110, 126
NdeII GATC 2 cut(s) 30, 49
PfeI GAWTC 1 cut(s) 140
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
SaqAI TTAA 3 cut(s) 90, 110, 126
Sau3AI GATC 2 cut(s) 30, 49
SchI GAGTC 1 cut(s) 20
SetI ASST 3 cut(s) 30, 116, 162
SgeI CNNG 5 cut(s) 35, 40, 49, 65, 79
SsiI CCGC 2 cut(s) 8, 133
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 1 cut(s) 30
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 3 cut(s) 90, 110, 126
Tru9I TTAA 3 cut(s) 90, 110, 126
TspDTI ATGAA 2 cut(s) 132, 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.