Rmu_co8354891.1_g000001

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8354891.1
OG0000545
Physical Location & Seq
Forward (+)
1 .. 915
915 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8354891.1_g000001.1.cds

Sequence Viewer

Length: 491 bp
aggacctgataggttccgagatggatgagaaagccgaagcgttagaggcggtggtgaaggaagcagtggatttggagaacgtacccattgaagaggtgtttctgaccttgaggtgtgacgaacatggactcacatctgaggctgctcagcagaggctggccatttttgggtacaacaagcttgaggagaagcaggaaagtaagattttgaagttcttggggtttatgtggaaccctctctcatgggtgatggaagctgcagctatcatggccattgctcttgccaatggaggaggaaagcctccagattggcaagactttgttgggatcattactctgctctttatcaattcaactataagttttattgaagagaacaacgctggaaatgctgctgctgctctcatggcccgtctcgcccccaaagccaaggtttgtaacccaatatcttatgcttgtgttagctttgctcttcttactgtagctatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

162

Amino Acids

17.6

Weight (kDa)

4.51

Isoelectric Point (pI)

35.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000545)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g36571
pyrus_communis pycom02g01560 pycom08g10820 pycom09g05820 pycom13g21850 pycom14g16010
rosa_chinensis RchiOBHm_Chr2g0094861 RchiOBHm_Chr2g0124911 RchiOBHm_Chr2g0138581 RchiOBHm_Chr2g0160851 RchiOBHm_Chr4g0407411
rosa_laevigata RLG00000001652 RLG00000001872 RLG00000002037 RLG00000003076 RLG00000006419 RLG00000016771 RLG00000017383 RLG00000022851 RLG00000030563 RLG00000033869 RLG00000034176
rosa_multiflora Rmu_co8013424.1_g000001 Rmu_co8016716.1_g000001 Rmu_co8183472.1_g000001 Rmu_co8254047.1_g000001 Rmu_co8354891.1_g000001 Rmu_sc0000124.1_g000003 Rmu_sc0002132.1_g000027 Rmu_sc0003007.1_g000011 Rmu_sc0003221.1_g000096 Rmu_sc0003221.1_g000097 Rmu_sc0005119.1_g000004 Rmu_sc0008057.1_g000005 Rmu_sc0034532.1_g000001 Rmu_sc0036406.1_g000001 Rmu_ssc0000008.1_g000009
rosa_roxburghii Rroxscaffold_1G00030520 Rroxscaffold_2G00107360 Rroxscaffold_2G00153420 Rroxscaffold_5G00335750 Rroxscaffold_5G00351760 Rroxscaffold_5G00352080 Rroxscaffold_6G00419090
rosa_rugosa Rorug01G0341800 Rorug01G0341900 Rorug02G0180200 Rorug02G0180300 Rorug03G0186100 Rorug03G0186200 Rorug03G0284800 Rorug04G0104500 Rorug05G0246300 Rorug06G0108400 Rorug06G0471500 Rorug06G0510400
rosa_samantha Rh1AG159000 Rh1CG148200 Rh1CG189900 Rh2AG552800 Rh2BG473900 Rh2BG612100 Rh2BG612300 Rh2DG094500 Rh2DG482600 Rh3BG234000 Rh3CG320000 Rh4AG144200 Rh4BG127900 Rh4DG097300 Rh5AG128900 Rh5AG381200 Rh5BG363000 Rh5DG491900 Rh6AG048400 Rh6BG168100 Rh6CG005800 Rh6DG006000 Rh7AG255100 Rh7BG360600 Rh7CG271700 Rh7CG482300 Rh7DG451200
rosa_wichuraiana Rw4G004970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AclWI GGATC 1 cut(s) 334
AcoI YGGCCR 2 cut(s) 158, 269
AfaI GTAC 2 cut(s) 83, 172
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 4 cut(s) 91, 210, 353, 370
AluBI AGCT 5 cut(s) 180, 256, 262, 464, 484
AluI AGCT 5 cut(s) 180, 256, 262, 464, 484
Alw26I GTCTC 1 cut(s) 418
AlwI GGATC 1 cut(s) 334
AlwNI CAGNNNCTG 1 cut(s) 156
AoxI GGCC 3 cut(s) 158, 269, 407
ApeKI GCWGC 6 cut(s) 142, 256, 259, 391, 394, 397
AspS9I GGNCC 2 cut(s) 3, 408
AsuHPI GGTGA 2 cut(s) 66, 258
AvaII GGWCC 1 cut(s) 3
BalI TGGCCA 2 cut(s) 160, 271
BbvI GCAGC 6 cut(s) 129, 243, 271, 378, 381, 384
BccI CCATC 2 cut(s) 15, 243
BcoDI GTCTC 1 cut(s) 418
BfmI CTRYAG 2 cut(s) 257, 479
BisI GCNGC 6 cut(s) 143, 257, 260, 392, 395, 398
BlpI GCTNAGC 1 cut(s) 146
BlsI GCNGC 6 cut(s) 144, 258, 261, 393, 396, 399
Bme18I GGWCC 1 cut(s) 3
BmgT120I GGNCC 2 cut(s) 3, 408
BmiI GGNNCC 2 cut(s) 15, 232
BpmI CTGGAG 1 cut(s) 287
Bpu1102I GCTNAGC 1 cut(s) 146
BpuEI CTTGAG 2 cut(s) 129, 202
BsaJI CCNNGG 1 cut(s) 428
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse3DI GCAATG 1 cut(s) 272
BseDI CCNNGG 1 cut(s) 428
BseGI GGATG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMI GCAATG 1 cut(s) 272
BseMII CTCAG 2 cut(s) 128, 160
BseRI GAGGAG 2 cut(s) 199, 305
BseXI GCAGC 6 cut(s) 129, 243, 271, 378, 381, 384
BshFI GGCC 3 cut(s) 160, 271, 409
BslI CCNNNNNNNGG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 418
BsmBI CGTCTC 1 cut(s) 418
BsnI GGCC 3 cut(s) 160, 271, 409
Bsp143I GATC 1 cut(s) 326
Bsp1720I GCTNAGC 1 cut(s) 146
BspACI CCGC 1 cut(s) 49
BspANI GGCC 3 cut(s) 160, 271, 409
BspCNI CTCAG 2 cut(s) 129, 159
BspLI GGNNCC 2 cut(s) 15, 232
BspMAI CTGCAG 1 cut(s) 261
BspPI GGATC 1 cut(s) 334
BspQI GCTCTTC 1 cut(s) 476
BsrDI GCAATG 1 cut(s) 272
BssECI CCNNGG 1 cut(s) 428
BssMI GATC 1 cut(s) 326
BssT1I CCWWGG 1 cut(s) 428
Bst4CI ACNGT 1 cut(s) 480
Bst6I CTCTTC 3 cut(s) 86, 365, 476
BstC8I GCNNGC 1 cut(s) 158
BstDEI CTNAG 2 cut(s) 137, 146
BstF5I GGATG 1 cut(s) 30
BstKTI GATC 1 cut(s) 329
BstMAI GTCTC 1 cut(s) 418
BstMBI GATC 1 cut(s) 326
BstMWI GCNNNNNNNGC 7 cut(s) 46, 268, 388, 397, 406, 415, 424
BstSFI CTRYAG 2 cut(s) 257, 479
BstV1I GCAGC 6 cut(s) 129, 243, 271, 378, 381, 384
BsuRI GGCC 3 cut(s) 160, 271, 409
BtsCI GGATG 1 cut(s) 30
BtsI GCAGTG 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 71
Cac8I GCNNGC 1 cut(s) 158
CaiI CAGNNNCTG 1 cut(s) 156
Cfr13I GGNCC 2 cut(s) 3, 408
Csp6I GTAC 2 cut(s) 82, 171
CviAII CATG 4 cut(s) 124, 242, 267, 405
CviQI GTAC 2 cut(s) 82, 171
DdeI CTNAG 2 cut(s) 137, 146
DpnI GATC 1 cut(s) 328
DpnII GATC 1 cut(s) 326
EaeI YGGCCR 2 cut(s) 158, 269
Eam1104I CTCTTC 3 cut(s) 86, 365, 476
EarI CTCTTC 3 cut(s) 86, 365, 476
Eco130I CCWWGG 1 cut(s) 428
Eco47I GGWCC 1 cut(s) 3
EcoO109I RGGNCCY 1 cut(s) 3
EcoT14I CCWWGG 1 cut(s) 428
ErhI CCWWGG 1 cut(s) 428
Esp3I CGTCTC 1 cut(s) 418
FaeI CATG 4 cut(s) 127, 245, 270, 408
FaiI YATR 7 cut(s) 125, 226, 243, 268, 358, 406, 452
FatI CATG 4 cut(s) 123, 241, 266, 404
Fnu4HI GCNGC 6 cut(s) 143, 257, 260, 392, 395, 398
FokI GGATG 1 cut(s) 37
Fsp4HI GCNGC 6 cut(s) 143, 257, 260, 392, 395, 398
GluI GCNGC 6 cut(s) 143, 257, 260, 392, 395, 398
GsuI CTGGAG 1 cut(s) 287
HaeIII GGCC 3 cut(s) 160, 271, 409
Hin1II CATG 4 cut(s) 127, 245, 270, 408
HindIII AAGCTT 1 cut(s) 178
HinfI GANTC 1 cut(s) 128
HphI GGTGA 2 cut(s) 66, 258
Hpy188I TCNGA 3 cut(s) 18, 104, 138
Hpy188III TCNNGA 1 cut(s) 304
HpyAV CCTTC 1 cut(s) 51
HpyCH4III ACNGT 1 cut(s) 480
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 259
HpyF10VI GCNNNNNNNGC 7 cut(s) 46, 268, 388, 397, 406, 415, 424
HpyF3I CTNAG 2 cut(s) 137, 146
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 4 cut(s) 127, 245, 270, 408
Kzo9I GATC 1 cut(s) 326
LguI GCTCTTC 1 cut(s) 476
LpnPI CCDG 5 cut(s) 19, 142, 178, 317, 368
Lsp1109I GCAGC 6 cut(s) 129, 243, 271, 378, 381, 384
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 2 cut(s) 115, 436
MalI GATC 1 cut(s) 328
MboI GATC 1 cut(s) 326
MboII GAAGA 3 cut(s) 103, 382, 463
MlsI TGGCCA 2 cut(s) 160, 271
MluCI AATT 1 cut(s) 348
MluNI TGGCCA 2 cut(s) 160, 271
MlyI GAGTC 1 cut(s) 122
Mox20I TGGCCA 2 cut(s) 160, 271
MscI TGGCCA 2 cut(s) 160, 271
Msp20I TGGCCA 2 cut(s) 160, 271
MwoI GCNNNNNNNGC 7 cut(s) 46, 268, 388, 397, 406, 415, 424
NdeII GATC 1 cut(s) 326
NlaIII CATG 4 cut(s) 127, 245, 270, 408
NlaIV GGNNCC 2 cut(s) 15, 232
NmuCI GTSAC 1 cut(s) 115
PciSI GCTCTTC 1 cut(s) 476
PkrI GCNGC 6 cut(s) 144, 258, 261, 393, 396, 399
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
PpuMI RGGWCCY 1 cut(s) 3
Psp5II RGGWCCY 1 cut(s) 3
PspN4I GGNNCC 2 cut(s) 15, 232
PspPI GGNCC 2 cut(s) 3, 408
PspPPI RGGWCCY 1 cut(s) 3
PstI CTGCAG 1 cut(s) 261
PstNI CAGNNNCTG 1 cut(s) 156
RsaI GTAC 2 cut(s) 83, 172
RsaNI GTAC 2 cut(s) 82, 171
SapI GCTCTTC 1 cut(s) 476
SatI GCNGC 6 cut(s) 143, 257, 260, 392, 395, 398
Sau3AI GATC 1 cut(s) 326
Sau96I GGNCC 2 cut(s) 3, 408
SchI GAGTC 1 cut(s) 122
SfcI CTRYAG 2 cut(s) 257, 479
SinI GGWCC 1 cut(s) 3
SmlI CTYRAG 2 cut(s) 108, 181
SmoI CTYRAG 2 cut(s) 108, 181
Sse9I AATT 1 cut(s) 348
SsiI CCGC 1 cut(s) 49
StyI CCWWGG 1 cut(s) 428
TaaI ACNGT 1 cut(s) 480
TaiI ACGT 1 cut(s) 83
TasI AATT 1 cut(s) 348
TscAI CASTG 1 cut(s) 71
TseFI GTSAC 1 cut(s) 115
TseI GCWGC 6 cut(s) 142, 256, 259, 391, 394, 397
Tsp45I GTSAC 1 cut(s) 115
TspRI CASTG 1 cut(s) 71
VpaK11BI GGWCC 1 cut(s) 3
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.