Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002481.1

Orthogroup ID

OG0000344

Physical Location & Seq

Genomic Coordinates Reverse (-)

160685 .. 162754

Gene Structure 2070 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002481.1_g000043.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgaagtcaggcgaagttttctctgagccgagtcaaaagtggtatgaaccagaatggtggaaggttggtgataaaaaatcatattttcgccatgcttcaggtgagatatattttcgccatgcttcatgtgagatgtatgacatttctcaaggtctggccaattttgttcgaataaatagagatattctccgtacctatgcccatgatgatgtcagtgtcggatcttggttaattgggcttgatgttaaacatcttaatgatgccaagttttgctgctcctcttggacagcaggagccatttgtgctggtgtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0006029 GO:0006464 GO:0006486 GO:0006493 GO:0006807 GO:0008150 GO:0008152 GO:0008378 GO:0009058 GO:0009059 GO:0009100 GO:0009101 GO:0009987 GO:0010384 GO:0010404 GO:0010405 GO:0012505 GO:0016740 GO:0016757 GO:0016758 GO:0018193 GO:0018208 GO:0018258 GO:0019538 GO:0031410 GO:0031982 GO:0031984 GO:0034645 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043413 GO:0044036 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0070085 GO:0071554 GO:0071704 GO:0097708 GO:0098791 GO:1901135 GO:1901137 GO:1901564 GO:1901566 GO:1901576 GO:1990714

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4094 Galactosyl_T

Protein Analysis

104

Amino Acids

11.9

Weight (kDa)

6.39

Isoelectric Point (pI)

33.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000344)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G19820
fragaria_vesca	FvH4_1g21410 FvH4_1g28300 FvH4_1g28300 FvH4_2g17651 FvH4_3g45470 FvH4_3g45470
malus_domestica	MD00G1158900.v1.1 MD03G1004600.v1.1 MD03G1004700.v1.1 MD05G1225200.v1.1 MD11G1005300.v1.1 MD11G1005800.v1.1
prunus_persica	Prupe.6G004500_v2.0.a1 Prupe.6G004500_v2.0.a1 Prupe.6G004500_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1
pyrus_communis	pycom03g00480 pycom03g00490 pycom03g00500 pycom11g00440 pycom11g00450
rosa_chinensis	RchiOBHm_Chr1g0324711 RchiOBHm_Chr2g0142151 RchiOBHm_Chr2g0142161 RchiOBHm_Chr3g0475691 RchiOBHm_Chr3g0496831 RchiOBHm_Chr4g0399761 RchiOBHm_Chr4g0399771 RchiOBHm_Chr4g0399781 RchiOBHm_Chr4g0419561 RchiOBHm_Chr5g0054221 RchiOBHm_Chr5g0078241 RchiOBHm_Chr5g0083261 RchiOBHm_Chr6g0253081 RchiOBHm_Chr6g0253091 RchiOBHm_Chr6g0253101
rosa_laevigata	RLG00000006894 RLG00000017613 RLG00000022498 RLG00000023521 RLG00000029311 RLG00000034357 RLG00000037024
rosa_multiflora	Rmu_co8031396.1_g000001 Rmu_co8481369.1_g000001 Rmu_sc0000455.1_g000002 Rmu_sc0000810.1_g000007 Rmu_sc0001438.1_g000001 Rmu_sc0001692.1_g000008 Rmu_sc0001692.1_g000009 Rmu_sc0002130.1_g000004 Rmu_sc0002481.1_g000043 Rmu_sc0004932.1_g000025 Rmu_sc0004967.1_g000012 Rmu_sc0006889.1_g000031 Rmu_sc0011792.1_g000006 Rmu_sc0013655.1_g000001 Rmu_sc0036178.1_g000001 Rmu_sc0040082.1_g000001 Rmu_sc0041125.1_g000001
rosa_roxburghii	Rroxscaffold_2G00138150 Rroxscaffold_4G00314380 Rroxscaffold_5G00362400 Rroxscaffold_6G00388660 Rroxscaffold_6G00393970
rosa_rugosa	Rorug02G0091400 Rorug03G0288200 Rorug03G0288200 Rorug05G0483800
rosa_samantha	Rh1AG440500 Rh2DG505100 Rh2DG505200 Rh3AG331800 Rh3BG368400 Rh3CG343100 Rh3CG364700 Rh3DG367800 Rh4BG222300 Rh4CG233300 Rh5AG533200 Rh5BG560500 Rh5CG583200 Rh5DG381000 Rh5DG569800 Rh6AG307400 Rh6AG307500 Rh6AG307600 Rh7AG013900 Rh7AG014000 Rh7AG153300 Rh7AG154100 Rh7AG283000 Rh7AG385300 Rh7AG446100 Rh7AG487800 Rh7CG302200 Rh7DG365100 Rh7DG365200
rosa_wichuraiana	Rw1G008740 Rw2G039350 Rw3G029040 Rw4G018940 Rw4G018950 Rw5G049970 Rw6G002460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	229
AcoI	YGGCCR	1 cut(s)	156
AcuI	CTGAAG	1 cut(s)	81
AfaI	GTAC	1 cut(s)	193
AlwI	GGATC	1 cut(s)	229
AoxI	GGCC	1 cut(s)	156
ApeKI	GCWGC	1 cut(s)	273
AsuHPI	GGTGA	2 cut(s)	80, 113
AsuII	TTCGAA	1 cut(s)	169
BalI	TGGCCA	1 cut(s)	158
BbvI	GCAGC	1 cut(s)	260
BisI	GCNGC	1 cut(s)	274
BlsI	GCNGC	1 cut(s)	275
BmiI	GGNNCC	1 cut(s)	295
BmsI	GCATC	1 cut(s)	250
BplI	GAGNNNNNCTC	2 cut(s)	171, 203
Bpu14I	TTCGAA	1 cut(s)	169
BpuEI	CTTGAG	1 cut(s)	132
BseMII	CTCAG	1 cut(s)	15
BseRI	GAGGAG	1 cut(s)	268
BseXI	GCAGC	1 cut(s)	260
BshFI	GGCC	1 cut(s)	158
BsnI	GGCC	1 cut(s)	158
Bsp119I	TTCGAA	1 cut(s)	169
Bsp143I	GATC	1 cut(s)	221
BspANI	GGCC	1 cut(s)	158
BspCNI	CTCAG	1 cut(s)	16
BspLI	GGNNCC	1 cut(s)	295
BspPI	GGATC	1 cut(s)	229
BspT104I	TTCGAA	1 cut(s)	169
BssMI	GATC	1 cut(s)	221
BstBI	TTCGAA	1 cut(s)	169
BstDEI	CTNAG	1 cut(s)	24
BstKTI	GATC	1 cut(s)	224
BstMBI	GATC	1 cut(s)	221
BstMWI	GCNNNNNNNGC	1 cut(s)	302
BstV1I	GCAGC	1 cut(s)	260
BstX2I	RGATCY	1 cut(s)	221
BstXI	CCANNNNNNTGG	1 cut(s)	57
BstYI	RGATCY	1 cut(s)	221
BsuRI	GGCC	1 cut(s)	158
BtsIMutI	CAGTG	1 cut(s)	220
Csp6I	GTAC	1 cut(s)	192
CviAII	CATG	4 cut(s)	92, 119, 126, 203
CviJI	RGCY	4 cut(s)	28, 158, 238, 296
CviKI_1	RGCY	4 cut(s)	28, 158, 238, 296
CviQI	GTAC	1 cut(s)	192
DdeI	CTNAG	1 cut(s)	24
DpnI	GATC	1 cut(s)	223
DpnII	GATC	1 cut(s)	221
EaeI	YGGCCR	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	81
FaeI	CATG	4 cut(s)	95, 122, 129, 206
FatI	CATG	4 cut(s)	91, 118, 125, 202
Fnu4HI	GCNGC	1 cut(s)	274
Fsp4HI	GCNGC	1 cut(s)	274
GluI	GCNGC	1 cut(s)	274
HaeIII	GGCC	1 cut(s)	158
Hin1II	CATG	4 cut(s)	95, 122, 129, 206
HinfI	GANTC	1 cut(s)	31
HphI	GGTGA	2 cut(s)	80, 113
Hpy188I	TCNGA	2 cut(s)	25, 221
HpyAV	CCTTC	1 cut(s)	55
HpyF10VI	GCNNNNNNNGC	1 cut(s)	302
HpyF3I	CTNAG	1 cut(s)	24
Hsp92II	CATG	4 cut(s)	95, 122, 129, 206
Kzo9I	GATC	1 cut(s)	221
LmnI	GCTCC	2 cut(s)	281, 293
LpnPI	CCDG	5 cut(s)	63, 84, 140, 276, 291
Lsp1109I	GCAGC	1 cut(s)	260
LweI	GCATC	1 cut(s)	250
MalI	GATC	1 cut(s)	223
MboI	GATC	1 cut(s)	221
MflI	RGATCY	1 cut(s)	221
MlsI	TGGCCA	1 cut(s)	158
MluCI	AATT	2 cut(s)	160, 231
MluNI	TGGCCA	1 cut(s)	158
MlyI	GAGTC	1 cut(s)	40
MmeI	TCCRAC	1 cut(s)	199
MnlI	CCTC	1 cut(s)	289
Mox20I	TGGCCA	1 cut(s)	158
MscI	TGGCCA	1 cut(s)	158
MseI	TTAA	3 cut(s)	230, 246, 255
MslI	CAYNNNNRTG	2 cut(s)	207, 255
Msp20I	TGGCCA	1 cut(s)	158
MwoI	GCNNNNNNNGC	1 cut(s)	302
NdeII	GATC	1 cut(s)	221
NlaIII	CATG	4 cut(s)	95, 122, 129, 206
NlaIV	GGNNCC	1 cut(s)	295
NmeAIII	GCCGAG	1 cut(s)	54
NspV	TTCGAA	1 cut(s)	169
PkrI	GCNGC	1 cut(s)	275
PleI	GAGTC	1 cut(s)	39
PpsI	GAGTC	1 cut(s)	39
PspN4I	GGNNCC	1 cut(s)	295
PsuI	RGATCY	1 cut(s)	221
RsaI	GTAC	1 cut(s)	193
RsaNI	GTAC	1 cut(s)	192
RseI	CAYNNNNRTG	2 cut(s)	207, 255
SaqAI	TTAA	3 cut(s)	230, 246, 255
SatI	GCNGC	1 cut(s)	274
Sau3AI	GATC	1 cut(s)	221
SchI	GAGTC	1 cut(s)	40
SetI	ASST	4 cut(s)	66, 103, 154, 197
SfaNI	GCATC	1 cut(s)	250
SfuI	TTCGAA	1 cut(s)	169
SmiMI	CAYNNNNRTG	2 cut(s)	207, 255
SmlI	CTYRAG	1 cut(s)	147
SmoI	CTYRAG	1 cut(s)	147
Sse9I	AATT	2 cut(s)	160, 231
TaqI	TCGA	1 cut(s)	169
TasI	AATT	2 cut(s)	160, 231
Tru1I	TTAA	3 cut(s)	230, 246, 255
Tru9I	TTAA	3 cut(s)	230, 246, 255
TscAI	CASTG	1 cut(s)	220
TseI	GCWGC	1 cut(s)	273
TspDTI	ATGAA	3 cut(s)	17, 60, 114
TspGWI	ACGGA	1 cut(s)	179
TspRI	CASTG	1 cut(s)	220

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.