Rroxscaffold_4G00314380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000344
Physical Location & Seq
Forward (+)
38369539 .. 38373974
4436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314380.1

Sequence Viewer

Length: 165 bp
ATGAACCAGAATGGTGGAAGTTTGGTGATAAAAAATCCTCCTATCATCATTGGTTTTGTCAAGGAACAAGCACTACAAAAAAGAATTTATGTAATTGATATTTTCGCCATGCTTCATGTGAGATGTATGACATTTCTCAAGGTCTGCCCAAATTTGTTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.19

Weight (kDa)

9.24

Isoelectric Point (pI)

32.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000344)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G19820
fragaria_vesca FvH4_1g21410 FvH4_1g28300 FvH4_1g28300 FvH4_2g17651 FvH4_3g45470 FvH4_3g45470
malus_domestica MD00G1158900.v1.1 MD03G1004600.v1.1 MD03G1004700.v1.1 MD05G1225200.v1.1 MD11G1005300.v1.1 MD11G1005800.v1.1
prunus_persica Prupe.6G004500_v2.0.a1 Prupe.6G004500_v2.0.a1 Prupe.6G004500_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1 Prupe.7G004800_v2.0.a1
pyrus_communis pycom03g00480 pycom03g00490 pycom03g00500 pycom11g00440 pycom11g00450
rosa_chinensis RchiOBHm_Chr1g0324711 RchiOBHm_Chr2g0142151 RchiOBHm_Chr2g0142161 RchiOBHm_Chr3g0475691 RchiOBHm_Chr3g0496831 RchiOBHm_Chr4g0399761 RchiOBHm_Chr4g0399771 RchiOBHm_Chr4g0399781 RchiOBHm_Chr4g0419561 RchiOBHm_Chr5g0054221 RchiOBHm_Chr5g0078241 RchiOBHm_Chr5g0083261 RchiOBHm_Chr6g0253081 RchiOBHm_Chr6g0253091 RchiOBHm_Chr6g0253101
rosa_laevigata RLG00000006894 RLG00000017613 RLG00000022498 RLG00000023521 RLG00000029311 RLG00000034357 RLG00000037024
rosa_multiflora Rmu_co8031396.1_g000001 Rmu_co8481369.1_g000001 Rmu_sc0000455.1_g000002 Rmu_sc0000810.1_g000007 Rmu_sc0001438.1_g000001 Rmu_sc0001692.1_g000008 Rmu_sc0001692.1_g000009 Rmu_sc0002130.1_g000004 Rmu_sc0002481.1_g000043 Rmu_sc0004932.1_g000025 Rmu_sc0004967.1_g000012 Rmu_sc0006889.1_g000031 Rmu_sc0011792.1_g000006 Rmu_sc0013655.1_g000001 Rmu_sc0036178.1_g000001 Rmu_sc0040082.1_g000001 Rmu_sc0041125.1_g000001
rosa_roxburghii Rroxscaffold_2G00138150 Rroxscaffold_4G00314380 Rroxscaffold_5G00362400 Rroxscaffold_6G00388660 Rroxscaffold_6G00393970
rosa_rugosa Rorug02G0091400 Rorug03G0288200 Rorug03G0288200 Rorug05G0483800
rosa_samantha Rh1AG440500 Rh2DG505100 Rh2DG505200 Rh3AG331800 Rh3BG368400 Rh3CG343100 Rh3CG364700 Rh3DG367800 Rh4BG222300 Rh4CG233300 Rh5AG533200 Rh5BG560500 Rh5CG583200 Rh5DG381000 Rh5DG569800 Rh6AG307400 Rh6AG307500 Rh6AG307600 Rh7AG013900 Rh7AG014000 Rh7AG153300 Rh7AG154100 Rh7AG283000 Rh7AG385300 Rh7AG446100 Rh7AG487800 Rh7CG302200 Rh7DG365100 Rh7DG365200
rosa_wichuraiana Rw1G008740 Rw2G039350 Rw3G029040 Rw4G018940 Rw4G018950 Rw5G049970 Rw6G002460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 84, 151
AgsI TTSAA 1 cut(s) 161
ApoI RAATTY 2 cut(s) 84, 151
AsuHPI GGTGA 1 cut(s) 37
BpuEI CTTGAG 1 cut(s) 122
BstXI CCANNNNNNTGG 1 cut(s) 14
CviAII CATG 2 cut(s) 109, 116
FaeI CATG 2 cut(s) 112, 119
FaiI YATR 4 cut(s) 90, 110, 117, 128
FatI CATG 2 cut(s) 108, 115
FspEI CC 9 cut(s) 8, 20, 36, 47, 51, 54, 121, 125, 161
Hin1II CATG 2 cut(s) 112, 119
HphI GGTGA 1 cut(s) 37
Hsp92II CATG 2 cut(s) 112, 119
LpnPI CCDG 1 cut(s) 20
MluCI AATT 3 cut(s) 84, 93, 151
MnlI CCTC 1 cut(s) 48
NlaIII CATG 2 cut(s) 112, 119
PsrI GAACNNNNNNTAC 2 cut(s) 57, 89
SetI ASST 1 cut(s) 144
SgeI CNNG 6 cut(s) 19, 73, 80, 121, 128, 151
SmlI CTYRAG 1 cut(s) 137
SmoI CTYRAG 1 cut(s) 137
Sse9I AATT 3 cut(s) 84, 93, 151
TasI AATT 3 cut(s) 84, 93, 151
TspDTI ATGAA 2 cut(s) 17, 104
XapI RAATTY 2 cut(s) 84, 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.