Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004847.1

Orthogroup ID

OG0000335

Physical Location & Seq

Genomic Coordinates Forward (+)

67627 .. 68721

Gene Structure 1095 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004847.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 831 bp

atgaaaaacattaagctatatgtgaggagggtgtttattatggacaactgcgaggagctcattccagagtatcttggatttgtcaagggtgttgtggactccgatgacttgccactcaacatttctcgtgagatgcttcaacagaacaagatcctgaaggtgatcaggaagaaccttatgaagaagtgcattgagatgttgaatgggattgctgagaacaaagaggattatgccaagttttatgagtcatttttcaaagaacttgacgagtatgatgggaagaagctcgtgtctgctacaaaggaaggtctgaagcttgacgatgaaactgaggaagagaagaagaagaagtcttttgagaatctttgcaagacaattaaagacatcttgggagacagggttgagaaggtggttgtgtccgatagaattgtcaactcaccttgctgcttggtcactggtgaatatggatggagtgcaaacatggagaggattatgaaggctcaggcactcagggacaacagcatgggtgctcacatgtccagcaagaagaccatggaaatcaaccctgacaatggcatcatggaggagctgaggaagagagccaaagctgacaaaaatgacaagtccgtcaaggaccttgtgctgctgctgtttgagacagctcttttgacatctggattcagccttgatgagcctaacacttttgcctcgagaattcacaggatgctgaagctggggcttagcatcgaagaagatgagactgttgaggatgcggacatgcctgagttggaggatgcagctgaggagagcaaaatggaggaggtggactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002376 GO:0006457 GO:0006950 GO:0006952 GO:0006955 GO:0008150 GO:0009605 GO:0009607 GO:0009617 GO:0009814 GO:0009816 GO:0009987 GO:0042742 GO:0043207 GO:0045087 GO:0050896 GO:0051704 GO:0051707 GO:0061077 GO:0098542

KEGG Pathways

Metabolic & Signaling

ko04141 ko04151 ko04217 ko04612 ko04621 ko04626 ko04657 ko04659 ko04914 ko04915 ko05200 ko05215 ko05418 map04141 map04151 map04217 map04612 map04621 map04626 map04657 map04659 map04914 map04915 map05200 map05215 map05418

Pfam Domains

Protein Families

HATPase_c HSP90

Protein Analysis

276

Amino Acids

31.67

Weight (kDa)

4.94

Isoelectric Point (pI)

42.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000335)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G52640
fragaria_vesca	FvH4_2g04730 FvH4_2g04730 FvH4_2g04730 FvH4_2g13180 FvH4_7g30260 FvH4_7g30272
malus_domestica	MD00G1081900.v1.1 MD01G1208700.v1.1 MD07G1279100.v1.1 MD07G1279200.v1.1 MD11G1152300.v1.1 MD14G1110500.v1.1 MD14G1110600.v1.1
prunus_persica	Prupe.2G301300_v2.0.a1 Prupe.5G041100_v2.0.a1 Prupe.5G105600_v2.0.a1
pyrus_communis	pycom01g21930 pycom07g25400 pycom09g11140 pycom14g10530
rosa_chinensis	RchiOBHm_Chr1g0327061 RchiOBHm_Chr1g0378391 RchiOBHm_Chr1g0379711 RchiOBHm_Chr3g0488481 RchiOBHm_Chr4g0387881 RchiOBHm_Chr5g0021331 RchiOBHm_Chr5g0021341 RchiOBHm_Chr5g0021351 RchiOBHm_Chr6g0274441 RchiOBHm_Chr7g0196751 RchiOBHm_Chr7g0196771
rosa_laevigata	RLG00000003992 RLG00000008392 RLG00000009018 RLG00000013542 RLG00000026364 RLG00000026365 RLG00000026438 RLG00000032605
rosa_multiflora	Rmu_co8309643.1_g000001 Rmu_co8423093.1_g000001 Rmu_co8520529.1_g000002 Rmu_sc0000938.1_g000001 Rmu_sc0001083.1_g000031 Rmu_sc0001289.1_g000016 Rmu_sc0001777.1_g000013 Rmu_sc0003392.1_g000006 Rmu_sc0003600.1_g000010 Rmu_sc0004484.1_g000024 Rmu_sc0004847.1_g000017 Rmu_sc0009850.1_g000016 Rmu_sc0013411.1_g000009 Rmu_sc0024337.1_g000001 Rmu_sc0024338.1_g000001 Rmu_sc0029385.1_g000001 Rmu_sc0039495.1_g000001 Rmu_ssc0000259.1_g000042
rosa_roxburghii	Rroxscaffold_1G00057180 Rroxscaffold_3G00258970 Rroxscaffold_3G00258980 Rroxscaffold_4G00280480 Rroxscaffold_7G00194220 Rroxscaffold_7G00197660
rosa_rugosa	Rorug01G0408500 Rorug05G0066400 Rorug05G0066500 Rorug06G0081900 Rorug07G0036200
rosa_samantha	Rh1AG083900 Rh1AG430000 Rh1AG438200 Rh1AG438300 Rh1BG387700 Rh1BG394700 Rh1BG394800 Rh1CG081800 Rh1CG401200 Rh1CG407700 Rh1CG407800 Rh1DG327400 Rh1DG418800 Rh1DG425100 Rh1DG425200 Rh2AG541400 Rh2CG384100 Rh2CG524100 Rh4DG107200 Rh5AG155400 Rh5AG155500 Rh5AG155600 Rh5BG155000 Rh5BG155100 Rh5CG168500 Rh5CG168600 Rh5CG168700 Rh5DG155600 Rh6AG198300 Rh6BG201600 Rh6BG491300 Rh6CG202400 Rh6DG192800 Rh7AG160000 Rh7AG160100 Rh7BG162200 Rh7CG168600 Rh7DG161300
rosa_wichuraiana	Rw1G037630 Rw5G013860 Rw6G017240 Rw7G013990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	626
AciI	CCGC	1 cut(s)	773
AclWI	GGATC	1 cut(s)	145
AcsI	RAATTY	1 cut(s)	714
AcuI	CTGAAG	3 cut(s)	176, 332, 749
AfiI	CCNNNNNNNGG	1 cut(s)	572
AflIII	ACRYGT	1 cut(s)	534
AgsI	TTSAA	3 cut(s)	140, 202, 256
AluBI	AGCT	9 cut(s)	16, 58, 286, 316, 589, 608, 662, 733, 800
AluI	AGCT	9 cut(s)	16, 58, 286, 316, 589, 608, 662, 733, 800
Alw21I	GWGCWC	2 cut(s)	60, 532
Alw26I	GTCTC	3 cut(s)	387, 650, 752
AlwI	GGATC	1 cut(s)	145
Ama87I	CYCGRG	1 cut(s)	709
ApeKI	GCWGC	4 cut(s)	444, 643, 646, 797
ApoI	RAATTY	1 cut(s)	714
ArsI	GACNNNNNNTTYG	2 cut(s)	649, 681
AspS9I	GGNCC	1 cut(s)	634
AsuHPI	GGTGA	3 cut(s)	172, 429, 470
AvaI	CYCGRG	1 cut(s)	709
AvaII	GGWCC	1 cut(s)	634
BanII	GRGCYC	1 cut(s)	60
BauI	CACGAG	2 cut(s)	126, 287
BbsI	GAAGAC	1 cut(s)	554
Bbv12I	GWGCWC	2 cut(s)	60, 532
BbvCI	CCTCAGC	2 cut(s)	590, 801
BbvI	GCAGC	4 cut(s)	431, 630, 633, 809
BccI	CCATC	2 cut(s)	269, 462
BclI	TGATCA	1 cut(s)	162
BcoDI	GTCTC	3 cut(s)	387, 650, 752
BisI	GCNGC	4 cut(s)	445, 644, 647, 798
BlpI	GCTNAGC	1 cut(s)	740
BlsI	GCNGC	4 cut(s)	446, 645, 648, 799
Bme18I	GGWCC	1 cut(s)	634
BmeT110I	CYCGRG	1 cut(s)	709
BmgT120I	GGNCC	1 cut(s)	634
BmsI	GCATC	6 cut(s)	123, 585, 714, 753, 760, 784
BpiI	GAAGAC	1 cut(s)	554
Bpu10I	CCTNAGC	3 cut(s)	501, 590, 801
Bpu1102I	GCTNAGC	1 cut(s)	740
BsaJI	CCNNGG	1 cut(s)	552
BsaXI	ACNNNNNCTCC	2 cut(s)	384, 414
Bsc4I	CCNNNNNNNGG	1 cut(s)	572
Bse1I	ACTGG	1 cut(s)	460
BseDI	CCNNGG	1 cut(s)	552
BseGI	GGATG	4 cut(s)	473, 729, 775, 799
BseLI	CCNNNNNNNGG	1 cut(s)	572
BseMII	CTCAG	7 cut(s)	204, 321, 515, 523, 581, 774, 792
BseNI	ACTGG	1 cut(s)	460
BseRI	GAGGAG	4 cut(s)	40, 68, 599, 818
BseXI	GCAGC	4 cut(s)	431, 630, 633, 809
BseYI	CCCAGC	1 cut(s)	733
BsiHKAI	GWGCWC	2 cut(s)	60, 532
BsiHKCI	CYCGRG	1 cut(s)	709
BslFI	GGGAC	1 cut(s)	527
BslI	CCNNNNNNNGG	1 cut(s)	572
BsmAI	GTCTC	3 cut(s)	387, 650, 752
BsmFI	GGGAC	1 cut(s)	527
BsoBI	CYCGRG	1 cut(s)	709
Bsp1286I	GDGCHC	2 cut(s)	60, 532
Bsp143I	GATC	2 cut(s)	150, 162
Bsp1720I	GCTNAGC	1 cut(s)	740
Bsp19I	CCATGG	1 cut(s)	552
BspACI	CCGC	1 cut(s)	773
BspCNI	CTCAG	7 cut(s)	205, 322, 514, 522, 582, 775, 793
BspPI	GGATC	1 cut(s)	145
BsrI	ACTGG	1 cut(s)	460
BssECI	CCNNGG	1 cut(s)	552
BssMI	GATC	2 cut(s)	150, 162
BssSI	CACGAG	2 cut(s)	126, 287
BssT1I	CCWWGG	1 cut(s)	552
Bst2BI	CACGAG	2 cut(s)	126, 287
Bst4CI	ACNGT	1 cut(s)	763
Bst6I	CTCTTC	2 cut(s)	330, 590
BstDEI	CTNAG	8 cut(s)	213, 330, 501, 509, 590, 740, 783, 801
BstDSI	CCRYGG	1 cut(s)	552
BstF5I	GGATG	4 cut(s)	473, 729, 775, 799
BstKTI	GATC	2 cut(s)	153, 165
BstMAI	GTCTC	3 cut(s)	387, 650, 752
BstMBI	GATC	2 cut(s)	150, 162
BstNSI	RCATGY	2 cut(s)	538, 781
BstV1I	GCAGC	4 cut(s)	431, 630, 633, 809
BstV2I	GAAGAC	1 cut(s)	554
BstX2I	RGATCY	1 cut(s)	150
BstYI	RGATCY	1 cut(s)	150
BtgI	CCRYGG	1 cut(s)	552
BtsCI	GGATG	4 cut(s)	473, 729, 775, 799
BtsIMutI	CAGTG	1 cut(s)	453
Cfr13I	GGNCC	1 cut(s)	634
CviAII	CATG	6 cut(s)	481, 523, 535, 553, 580, 778
DdeI	CTNAG	8 cut(s)	213, 330, 501, 509, 590, 740, 783, 801
DpnI	GATC	2 cut(s)	152, 164
DpnII	GATC	2 cut(s)	150, 162
DrdI	GACNNNNNNGTC	1 cut(s)	626
DseDI	GACNNNNNNGTC	1 cut(s)	626
Eam1104I	CTCTTC	2 cut(s)	330, 590
EarI	CTCTTC	2 cut(s)	330, 590
Ecl136II	GAGCTC	1 cut(s)	58
Eco130I	CCWWGG	1 cut(s)	552
Eco24I	GRGCYC	1 cut(s)	60
Eco47I	GGWCC	1 cut(s)	634
Eco53kI	GAGCTC	1 cut(s)	58
Eco57I	CTGAAG	3 cut(s)	176, 332, 749
Eco88I	CYCGRG	1 cut(s)	709
EcoICRI	GAGCTC	1 cut(s)	58
EcoO109I	RGGNCCY	1 cut(s)	634
EcoRI	GAATTC	1 cut(s)	714
EcoT14I	CCWWGG	1 cut(s)	552
EcoT38I	GRGCYC	1 cut(s)	60
ErhI	CCWWGG	1 cut(s)	552
FaeI	CATG	6 cut(s)	484, 526, 538, 556, 583, 781
FaqI	GGGAC	1 cut(s)	527
FatI	CATG	6 cut(s)	480, 522, 534, 552, 579, 777
FbaI	TGATCA	1 cut(s)	162
Fnu4HI	GCNGC	4 cut(s)	445, 644, 647, 798
FokI	GGATG	4 cut(s)	480, 736, 782, 806
FriOI	GRGCYC	1 cut(s)	60
Fsp4HI	GCNGC	4 cut(s)	445, 644, 647, 798
GluI	GCNGC	4 cut(s)	445, 644, 647, 798
GsaI	CCCAGC	1 cut(s)	737
Hin1II	CATG	6 cut(s)	484, 526, 538, 556, 583, 781
HincII	GTYRAC	1 cut(s)	433
HindII	GTYRAC	1 cut(s)	433
HindIII	AAGCTT	1 cut(s)	314
HinfI	GANTC	4 cut(s)	98, 245, 361, 678
HphI	GGTGA	3 cut(s)	172, 429, 470
Hpy166II	GTNNAC	3 cut(s)	97, 433, 826
Hpy188I	TCNGA	3 cut(s)	103, 312, 421
Hpy188III	TCNNGA	6 cut(s)	65, 128, 154, 166, 675, 711
Hpy8I	GTNNAC	3 cut(s)	97, 433, 826
HpyAV	CCTTC	4 cut(s)	151, 299, 400, 490
HpyCH4III	ACNGT	1 cut(s)	763
HpyCH4V	TGCA	4 cut(s)	189, 369, 476, 797
HpyF3I	CTNAG	8 cut(s)	213, 330, 501, 509, 590, 740, 783, 801
Hsp92II	CATG	6 cut(s)	484, 526, 538, 556, 583, 781
Ksp22I	TGATCA	1 cut(s)	162
Kzo9I	GATC	2 cut(s)	150, 162
LmnI	GCTCC	2 cut(s)	55, 586
Lsp1109I	GCAGC	4 cut(s)	431, 630, 633, 809
LweI	GCATC	6 cut(s)	123, 585, 714, 753, 760, 784
MaeIII	GTNAC	1 cut(s)	451
MalI	GATC	2 cut(s)	152, 164
MboI	GATC	2 cut(s)	150, 162
MflI	RGATCY	1 cut(s)	150
MhlI	GDGCHC	2 cut(s)	60, 532
MluCI	AATT	3 cut(s)	375, 426, 714
MlyI	GAGTC	2 cut(s)	92, 254
MmeI	TCCRAC	1 cut(s)	768
MseI	TTAA	2 cut(s)	12, 378
MslI	CAYNNNNRTG	1 cut(s)	194
MspA1I	CMGCKG	1 cut(s)	800
NcoI	CCATGG	1 cut(s)	552
NdeII	GATC	2 cut(s)	150, 162
NlaIII	CATG	6 cut(s)	484, 526, 538, 556, 583, 781
NmuCI	GTSAC	1 cut(s)	451
NspI	RCATGY	2 cut(s)	538, 781
PaeR7I	CTCGAG	1 cut(s)	709
PciI	ACATGT	1 cut(s)	534
PfeI	GAWTC	2 cut(s)	361, 678
PkrI	GCNGC	4 cut(s)	446, 645, 648, 799
PleI	GAGTC	2 cut(s)	92, 253
PpsI	GAGTC	2 cut(s)	92, 253
PpuMI	RGGWCCY	1 cut(s)	634
PscI	ACATGT	1 cut(s)	534
Psp124BI	GAGCTC	1 cut(s)	60
Psp5II	RGGWCCY	1 cut(s)	634
PspFI	CCCAGC	1 cut(s)	733
PspPI	GGNCC	1 cut(s)	634
PspPPI	RGGWCCY	1 cut(s)	634
PsuI	RGATCY	1 cut(s)	150
PvuII	CAGCTG	1 cut(s)	800
RseI	CAYNNNNRTG	1 cut(s)	194
SacI	GAGCTC	1 cut(s)	60
SaqAI	TTAA	2 cut(s)	12, 378
SatI	GCNGC	4 cut(s)	445, 644, 647, 798
Sau3AI	GATC	2 cut(s)	150, 162
Sau96I	GGNCC	1 cut(s)	634
SchI	GAGTC	2 cut(s)	92, 254
SduI	GDGCHC	2 cut(s)	60, 532
SfaNI	GCATC	6 cut(s)	123, 585, 714, 753, 760, 784
Sfr274I	CTCGAG	1 cut(s)	709
SinI	GGWCC	1 cut(s)	634
SlaI	CTCGAG	1 cut(s)	709
SmiMI	CAYNNNNRTG	1 cut(s)	194
SmlI	CTYRAG	1 cut(s)	709
SmoI	CTYRAG	1 cut(s)	709
Sse9I	AATT	3 cut(s)	375, 426, 714
SsiI	CCGC	1 cut(s)	773
SstI	GAGCTC	1 cut(s)	60
StyI	CCWWGG	1 cut(s)	552
TaaI	ACNGT	1 cut(s)	763
TaqI	TCGA	2 cut(s)	710, 747
TasI	AATT	3 cut(s)	375, 426, 714
TfiI	GAWTC	2 cut(s)	361, 678
Tru1I	TTAA	2 cut(s)	12, 378
Tru9I	TTAA	2 cut(s)	12, 378
TscAI	CASTG	1 cut(s)	460
TseFI	GTSAC	1 cut(s)	451
TseI	GCWGC	4 cut(s)	444, 643, 646, 797
Tsp45I	GTSAC	1 cut(s)	451
TspDTI	ATGAA	4 cut(s)	17, 194, 339, 509
TspGWI	ACGGA	1 cut(s)	616
TspRI	CASTG	1 cut(s)	460
VpaK11BI	GGWCC	1 cut(s)	634
XapI	RAATTY	1 cut(s)	714
XceI	RCATGY	2 cut(s)	538, 781
XhoI	CTCGAG	1 cut(s)	709

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.