Rh1CG081800

Heat shock protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
17095570 .. 17117312
21743 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG081800.1

Sequence Viewer

Length: 279 bp
ATGGCTGATGTTTACATTGGTGATGCTGAGACATTTGCATTCCACGTAGAGATCAACAGGCTTGTTAGCTTGATCATCAGTACCTTTTACAGCAACAAAGAAATATTCCTAGGCCAACCTATTAGCAATTGCAATGATATAATAAAGAAATTTCTAAGTGTAGCAAAAGGCGTGAAACGTGTAGCTAAAGATGTGAAAGGTGTAACCTTTTTAAGCCTTTCTGCCTTGCCATTGAATCAGAGGTGGAATACAAGAAAAAAAATTCCTTTTGAGCCTTGA

Protein Analysis

92

Amino Acids

10.4

Weight (kDa)

9.61

Isoelectric Point (pI)

35.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000335)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G52640
fragaria_vesca FvH4_2g04730 FvH4_2g04730 FvH4_2g04730 FvH4_2g13180 FvH4_7g30260 FvH4_7g30272
malus_domestica MD00G1081900.v1.1 MD01G1208700.v1.1 MD07G1279100.v1.1 MD07G1279200.v1.1 MD11G1152300.v1.1 MD14G1110500.v1.1 MD14G1110600.v1.1
prunus_persica Prupe.2G301300_v2.0.a1 Prupe.5G041100_v2.0.a1 Prupe.5G105600_v2.0.a1
pyrus_communis pycom01g21930 pycom07g25400 pycom09g11140 pycom14g10530
rosa_chinensis RchiOBHm_Chr1g0327061 RchiOBHm_Chr1g0378391 RchiOBHm_Chr1g0379711 RchiOBHm_Chr3g0488481 RchiOBHm_Chr4g0387881 RchiOBHm_Chr5g0021331 RchiOBHm_Chr5g0021341 RchiOBHm_Chr5g0021351 RchiOBHm_Chr6g0274441 RchiOBHm_Chr7g0196751 RchiOBHm_Chr7g0196771
rosa_laevigata RLG00000003992 RLG00000008392 RLG00000009018 RLG00000013542 RLG00000026364 RLG00000026365 RLG00000026438 RLG00000032605
rosa_multiflora Rmu_co8309643.1_g000001 Rmu_co8423093.1_g000001 Rmu_co8520529.1_g000002 Rmu_sc0000938.1_g000001 Rmu_sc0001083.1_g000031 Rmu_sc0001289.1_g000016 Rmu_sc0001777.1_g000013 Rmu_sc0003392.1_g000006 Rmu_sc0003600.1_g000010 Rmu_sc0004484.1_g000024 Rmu_sc0004847.1_g000017 Rmu_sc0009850.1_g000016 Rmu_sc0013411.1_g000009 Rmu_sc0024337.1_g000001 Rmu_sc0024338.1_g000001 Rmu_sc0029385.1_g000001 Rmu_sc0039495.1_g000001 Rmu_ssc0000259.1_g000042
rosa_roxburghii Rroxscaffold_1G00057180 Rroxscaffold_3G00258970 Rroxscaffold_3G00258980 Rroxscaffold_4G00280480 Rroxscaffold_7G00194220 Rroxscaffold_7G00197660
rosa_rugosa Rorug01G0408500 Rorug05G0066400 Rorug05G0066500 Rorug06G0081900 Rorug07G0036200
rosa_samantha Rh1AG083900 Rh1AG430000 Rh1AG438200 Rh1AG438300 Rh1BG387700 Rh1BG394700 Rh1BG394800 Rh1CG081800 Rh1CG401200 Rh1CG407700 Rh1CG407800 Rh1DG327400 Rh1DG418800 Rh1DG425100 Rh1DG425200 Rh2AG541400 Rh2CG384100 Rh2CG524100 Rh4DG107200 Rh5AG155400 Rh5AG155500 Rh5AG155600 Rh5BG155000 Rh5BG155100 Rh5CG168500 Rh5CG168600 Rh5CG168700 Rh5DG155600 Rh6AG198300 Rh6BG201600 Rh6BG491300 Rh6CG202400 Rh6DG192800 Rh7AG160000 Rh7AG160100 Rh7BG162200 Rh7CG168600 Rh7DG161300
rosa_wichuraiana Rw1G037630 Rw5G013860 Rw6G017240 Rw7G013990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 149, 261
AfaI GTAC 1 cut(s) 82
AflIII ACRYGT 1 cut(s) 178
AgsI TTSAA 1 cut(s) 235
AluBI AGCT 2 cut(s) 69, 185
AluI AGCT 2 cut(s) 69, 185
Alw26I GTCTC 1 cut(s) 23
AoxI GGCC 1 cut(s) 112
ApoI RAATTY 2 cut(s) 149, 261
AspA2I CCTAGG 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 32
AvrII CCTAGG 1 cut(s) 109
BclI TGATCA 1 cut(s) 72
BcoDI GTCTC 1 cut(s) 23
BfaI CTAG 1 cut(s) 110
BlnI CCTAGG 1 cut(s) 109
BmsI GCATC 1 cut(s) 13
BsaAI YACGTR 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 109
Bse3DI GCAATG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 109
BseMI GCAATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 18
BshFI GGCC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 23
BsmI GAATGC 1 cut(s) 38
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 51, 72
BspANI GGCC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 19
BsrDI GCAATG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 109
BssMI GATC 2 cut(s) 51, 72
BssT1I CCWWGG 1 cut(s) 109
BstBAI YACGTR 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 27, 155
BstKTI GATC 2 cut(s) 54, 75
BstMAI GTCTC 1 cut(s) 23
BstMBI GATC 2 cut(s) 51, 72
BsuRI GGCC 1 cut(s) 114
Csp6I GTAC 1 cut(s) 81
CviJI RGCY 7 cut(s) 5, 61, 69, 114, 185, 216, 274
CviKI_1 RGCY 7 cut(s) 5, 61, 69, 114, 185, 216, 274
CviQI GTAC 1 cut(s) 81
DdeI CTNAG 2 cut(s) 27, 155
DpnI GATC 2 cut(s) 53, 74
DpnII GATC 2 cut(s) 51, 72
Eco130I CCWWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 109
ErhI CCWWGG 1 cut(s) 109
FaiI YATR 1 cut(s) 140
FbaI TGATCA 1 cut(s) 72
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 114
HinfI GANTC 1 cut(s) 235
HphI GGTGA 1 cut(s) 32
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 240
Hpy8I GTNNAC 1 cut(s) 13
HpyCH4IV ACGT 2 cut(s) 45, 178
HpyCH4V TGCA 2 cut(s) 38, 132
HpyF3I CTNAG 2 cut(s) 27, 155
HpySE526I ACGT 2 cut(s) 45, 178
Ksp22I TGATCA 1 cut(s) 72
Kzo9I GATC 2 cut(s) 51, 72
LpnPI CCDG 1 cut(s) 43
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 110
MaeII ACGT 2 cut(s) 45, 178
MaeIII GTNAC 1 cut(s) 202
MalI GATC 2 cut(s) 53, 74
MboI GATC 2 cut(s) 51, 72
MfeI CAATTG 1 cut(s) 127
MluCI AATT 3 cut(s) 127, 149, 261
MnlI CCTC 1 cut(s) 234
MseI TTAA 1 cut(s) 212
MunI CAATTG 1 cut(s) 127
Mva1269I GAATGC 1 cut(s) 38
NdeII GATC 2 cut(s) 51, 72
PctI GAATGC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 235
Ppu21I YACGTR 1 cut(s) 46
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 212
Sau3AI GATC 2 cut(s) 51, 72
SetI ASST 9 cut(s) 48, 71, 86, 121, 181, 187, 202, 209, 245
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 9 cut(s) 56, 70, 74, 82, 122, 184, 191, 238, 264
Sse9I AATT 3 cut(s) 127, 149, 261
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 110
StyI CCWWGG 1 cut(s) 109
TaiI ACGT 2 cut(s) 48, 181
TasI AATT 3 cut(s) 127, 149, 261
TfiI GAWTC 1 cut(s) 235
Tru1I TTAA 1 cut(s) 212
Tru9I TTAA 1 cut(s) 212
XapI RAATTY 2 cut(s) 149, 261
XmaJI CCTAGG 1 cut(s) 109
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.