Rmu_sc0006084.1_g000009

Disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006084.1
OG0000379
Physical Location & Seq
Forward (+)
52734 .. 60375
7642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006084.1_g000009.1.cds

Sequence Viewer

Length: 3789 bp
atggatgcctcttcatctgttccttcatcatcatcagctcgtccgtggatgtatgatgtgtttttgagtttcaggggtcctgacactcgaaggggtattacatccgatctatacgatcggctgcaaaagagaggaattaaaacattcatggatgaccaagatcttcaagtaggggatgggatttcttccactctcatagcagcaattgaaaaatcaaggtttgcaatcgttgttctgtcggaaaactatgctgattctgcttggtgtttggaggaacttacaaagatttgtgagtgcacggaagaaagcaaaggaatttttccgcttttctataatgtggacccctctgatgttcggcaccggaagaggagtttcggagaagctttcgataagcatggaagctctgggcgacacgcatcagagaaggtgcagcggtggaatgatgctttatacaaagtggctagtttctctgggtgggatacaaagaattacaagactgatagagaacttgtggtggaaatcgtggattttgtgtgcagtaaaatacaaccggagattccaatgtctaccggagattttgaagcgtttgaagcaacaacaaaagccatggatgaggttatgaaagcgcttaaagatgacgacgtcactgccattggggtctacggaatgggcggtgtcggcaagacaaccatggtaaaacatgttgctgcacaatccaaaataggtgggatttttgattatgtgattattggtgtggtatcccagagccctgacttgacaaagattcaaggcacattggcagatacattgggcattacattggcgggagagacagaatttggaagagctgctagattgcatacggagataatgagaagagaaaagatccttataatcttggacgatgtttggaacagaatagaattgtcagacatagggattcccagcgacgaggagcttcaaaagaacaattccaaagtcgtcctcaccacgcggagattgcatgtttgtaattccatggacagccaagcaagcattcctctcagtatcttatcagaacaagattcttggaaattgtttgctagaaatgcaagaaggtcttttgaatcccccaatcatttttataatgtagcgaggaaggtagctggagaatgcgggggtctacccattgcattgatagcagttgcaagggcactcagagataaagatgagggggaatgggaaaaagcagctcaacgactagagaagtcgcaatctgcaaccgttgaggatgggggagatgccttcaaatgtataaaatttagctatgattacttgaaaaatgaggactacaagtcatgcttcttgctgtgttgcctatttccagaagactatgacatctcaatagaaaaattgttccggtatgcaattgggaaaggattgtttcgtgataccgacacaatatatgaagccagaggaacagcagattcagtggtcaagtacctgaaagattctagcttgcttttgaagagtgaattcattggatgtgtaaagatgcatgatgtcgtccgggatacagctatgagaattgcagaatgcaaatatgggcgtgggtttttggtgaaagctggacggggtttagatcattggtcatgtcgatcacatgaaggctactctgcaatctcactaatgcggaataaaattcgccgtctacccaaagagttggtaagtccaaaactccaaattcgccgtctacccaaagagttggtaagtccaaaactccaaattttattactacaagggaatactgatttatatgagatcccagagacctttttcccgagtcccaatgaattaatgcttttggatcttagcataactagtatttcctctctaccccaatctttcagtctccttaccaacctccaagctttgtatttagattcttgcaaaaacttgattgacatttctgtagtgggagaactgaagaagcttgaaattcttagtatgagggagtatcttggggggcgattgccgagagaaataggaaatttgacctatctaaggattttggaagtcagtggctcttcggtagtcacaattccatctaaagtgatatcaaagttgcataaattagaagaattgtacatgcgggagtgtggatttgtggactgggggtgtgaaattgagggacaaggaggagaaaccaatattgggtttgatgagttagctggtttatcatatttgaaagttttggaggttttcatatctgatgcaaaatacatccctaaaaatgttgaggccgaaccgaattgggtttactttcacatacgtattggcgaaaacatacgagatttctacagtcgagaagatcattatccaagattcttgtatcttgaaggaaacataagtaccttgcctgattggtttatcaacgcggtgacagagaaaacagagaagctactttatcatggctgcgaagggatgagtgaccttcttctggaatatgaccatgggaggttacataaactcaagcatctcaaagttgatggggaggattttcgtgattcctatgtgtacatgacagagttgatgaatacaacaagacgggttcaaaaaggaccagtgtttgagaatttggaagagttgtatttgtattctctgatccaccttaaggagttgtgtgttggtgagttaccacctgggtctttctccaatctcaaggtattgcatctaaaaaactgtagtatcataaagaatgtatcaaaattggtacagagactaccaaatctggagaaactagatttaaactgtatgcacggattggaatatgtgtttggatgcgaagggttcaagccagaacaatcaaaactgagagagatgcatttgttggatctagacgcactgagaagcatatgtaatggtcctcctcctcgcgtaatgttccagagtcttaaaagtttgatcttttaccgctgtgagctgctgcaaagtctgttcacatctgatgtagctcagtgtcttgatcaattggaagacctttttgtagaggcgtgccctttgctggaaagagtaattgaagcagtgaacaaggagaagacggttcttccaaatttgaagaacatgattttgaatgaacttcccgtgttgtacggtgcaagtgctactgttgatattgagtgtcctttattggaacgcttgattgtgggggattgcccccagatttcattttcaacctctccatctcgcttccgctacaaagggagccaggtttcattttcaacctctgcttctgactactttggcagcacgaacccagtccaactcaatgatccacaactgtacagattattgcgtctgagtacatgtaatggtcctgctgacttgcaatggtccctcagcttctggcttccagggcaggaagtaaccaagttcaaccctattgctttgcccagggttggtcatctagctgaggctgcgtatccaattgatacacttgaagctttgctggatcgtgactttcaaaacagccaaagagatttcccagtctccccaggagccgactgcgagcacaaccgccactgttacttccagcgaagcaaggcgcttgacgaagaagtcaggtcacgggactaccccaacgactgcaccccgaggtgctggcacgcctgcgcaaccactcgcccaaaagagactgtttgcacaccagctggttttggagccaaacacaatcacaaaacaacaatcgaattctaccctgaatccaatacccatcgctttgaatccaatacccatcgcttccaatgctga

Protein Analysis

1262

Amino Acids

143.07

Weight (kDa)

5.79

Isoelectric Point (pI)

48.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000379)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g17740 FvH4_1g17740 FvH4_1g17740 FvH4_1g17740 FvH4_3g42940 FvH4_3g43860 FvH4_3g43860 FvH4_3g43860 FvH4_3g43860 FvH4_3g43860 FvH4_3g43860 FvH4_3g43871 FvH4_3g43880 FvH4_3g43880 FvH4_3g43880 FvH4_3g43880 FvH4_3g43880 FvH4_3g43940 FvH4_3g43991 FvH4_3g44561 FvH4_3g44570 FvH4_3g44610 FvH4_3g44670 FvH4_3g44670 FvH4_3g44680 FvH4_3g44680 FvH4_3g44680 FvH4_3g45170 FvH4_3g45170 FvH4_3g45170 FvH4_3g45170 FvH4_3g45630 FvH4_3g45643 FvH4_3g45680 FvH4_3g45690 FvH4_3g45700 FvH4_3g45700 FvH4_3g45700 FvH4_3g45700 FvH4_3g45711 FvH4_3g45711 FvH4_3g45711 FvH4_3g45711 FvH4_3g45711 FvH4_3g45730 FvH4_3g45730 FvH4_3g45730 FvH4_3g45730 FvH4_3g45730 FvH4_3g45730
malus_domestica MD11G1020200.v1.1 MD15G1398500.v1.1
rosa_chinensis RchiOBHm_Chr1g0326201 RchiOBHm_Chr5g0064091 RchiOBHm_Chr5g0076771 RchiOBHm_Chr5g0078181 RchiOBHm_Chr5g0078321 RchiOBHm_Chr5g0079331 RchiOBHm_Chr5g0079341 RchiOBHm_Chr5g0079351 RchiOBHm_Chr5g0079361 RchiOBHm_Chr5g0079441 RchiOBHm_Chr5g0079821 RchiOBHm_Chr5g0080071 RchiOBHm_Chr7g0212731 RchiOBHm_Chr7g0224201
rosa_laevigata RLG00000002871
rosa_multiflora Rmu_co8378879.1_g000001 Rmu_co8466133.1_g000001 Rmu_sc0000595.1_g000019 Rmu_sc0000616.1_g000025 Rmu_sc0000631.1_g000033 Rmu_sc0000945.1_g000004 Rmu_sc0001148.1_g000022 Rmu_sc0001226.1_g000016 Rmu_sc0002187.1_g000037 Rmu_sc0006084.1_g000005 Rmu_sc0006084.1_g000009 Rmu_sc0006084.1_g000019 Rmu_sc0006084.1_g000021
rosa_roxburghii Rroxscaffold_1G00001540 Rroxscaffold_1G00003210 Rroxscaffold_1G00003250 Rroxscaffold_1G00003340 Rroxscaffold_1G00003580 Rroxscaffold_1G00003940 Rroxscaffold_3G00228660 Rroxscaffold_3G00247850
rosa_rugosa Rorug05G0465800 Rorug05G0466100 Rorug07G0125700 Rorug07G0136300
rosa_wichuraiana Rw0G005160 Rw0G022760 Rw5G047710 Rw5G048070 Rw5G048080 Rw5G048150 Rw5G048180 Rw5G048210 Rw5G048250 Rw5G048290 Rw7G023250 Rw7G030960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 893, 1125
AasI GACNNNNNNGTC 1 cut(s) 3596
AatII GACGTC 1 cut(s) 645
Acc16I TGCGCA 1 cut(s) 3652
AccB1I GGYRCC 1 cut(s) 357
AccI GTMKAC 5 cut(s) 566, 660, 1162, 1690, 1732
AccII CGCG 3 cut(s) 994, 2417, 2916
AclWI GGATC 7 cut(s) 880, 1795, 1854, 2638, 2880, 3305, 3498
AcuI CTGAAG 1 cut(s) 1985
AcyI GRCGYC 1 cut(s) 642
AfaI GTAC 8 cut(s) 1481, 2126, 2392, 2558, 2754, 3131, 3323, 3343
AfeI AGCGCT 1 cut(s) 627
AfiI CCNNNNNNNGG 6 cut(s) 2043, 2193, 2479, 2653, 3043, 3437
AflII CTTAAG 1 cut(s) 2651
AflIII ACRYGT 2 cut(s) 700, 3344
AhdI GACNNNNNGTC 1 cut(s) 1333
AhlI ACTAGT 1 cut(s) 1859
AjnI CCWGG 5 cut(s) 2680, 3246, 3391, 3431, 3532
AjuI GAANNNNNNNTTGG 6 cut(s) 1020, 1052, 2175, 2207, 2799, 2831
Alw21I GWGCWC 2 cut(s) 299, 3552
Alw26I GTCTC 6 cut(s) 824, 1802, 1895, 2752, 3532, 3665
Alw44I GTGCAC 1 cut(s) 295
AlwI GGATC 7 cut(s) 880, 1795, 1854, 2638, 2880, 3305, 3498
AlwNI CAGNNNCTG 1 cut(s) 3384
Ama87I CYCGRG 2 cut(s) 1819, 3631
Aor51HI AGCGCT 1 cut(s) 627
AoxI GGCC 1 cut(s) 2280
ApaLI GTGCAC 1 cut(s) 295
ArsI GACNNNNNNTTYG 2 cut(s) 1714, 1746
AseI ATTAAT 1 cut(s) 1835
AspLEI GCGC 3 cut(s) 628, 3586, 3653
AspS9I GGNCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
AsuC2I CCSGG 1 cut(s) 1550
AsuHPI GGTGA 4 cut(s) 979, 1612, 2431, 2681
AvaI CYCGRG 2 cut(s) 1819, 3631
AvaII GGWCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
BaeGI GKGCMC 3 cut(s) 299, 1195, 3038
BaeI ACNNNNGTAYC 4 cut(s) 2374, 2407, 2710, 2743
BanI GGYRCC 1 cut(s) 357
BanII GRGCYC 1 cut(s) 770
BarI GAAGNNNNNNTAC 2 cut(s) 82, 114
BbsI GAAGAC 3 cut(s) 1374, 3021, 3083
Bbv12I GWGCWC 2 cut(s) 299, 3552
BbvCI CCTCAGC 2 cut(s) 3377, 3450
BccI CCATC 7 cut(s) 170, 1265, 2092, 2522, 3229, 3759, 3780
BceAI ACGGC 2 cut(s) 1671, 1713
BcgI CGANNNNNNTGC 2 cut(s) 629, 663
BciT130I CCWGG 5 cut(s) 2682, 3248, 3393, 3433, 3534
BciVI GTATCC 4 cut(s) 472, 769, 1546, 3471
BclI TGATCA 1 cut(s) 3004
BcnI CCSGG 1 cut(s) 1550
BcoDI GTCTC 6 cut(s) 824, 1802, 1895, 2752, 3532, 3665
BcuI ACTAGT 1 cut(s) 1859
BfaI CTAG 9 cut(s) 462, 852, 1083, 1241, 1494, 1860, 2780, 2876, 3446
BfmI CTRYAG 3 cut(s) 1950, 2338, 2722
BfoI RGCGCY 2 cut(s) 629, 3587
BfrI CTTAAG 1 cut(s) 2651
BfuI GTATCC 4 cut(s) 472, 769, 1546, 3471
BglII AGATCT 1 cut(s) 160
Bme1390I CCNGG 6 cut(s) 1550, 2682, 3248, 3393, 3433, 3534
Bme18I GGWCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
BmeRI GACNNNNNGTC 1 cut(s) 1333
BmeT110I CYCGRG 2 cut(s) 1819, 3631
BmgT120I GGNCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
BmiI GGNNCC 7 cut(s) 78, 342, 359, 3245, 3374, 3538, 3700
BmrFI CCNGG 6 cut(s) 1550, 2682, 3248, 3393, 3433, 3534
BmrI ACTGGG 3 cut(s) 2161, 3290, 3518
BmsI GCATC 9 cut(s) 425, 433, 1270, 1524, 2242, 2524, 2719, 2810, 2850
BmuI ACTGGG 3 cut(s) 2161, 3290, 3518
BpiI GAAGAC 3 cut(s) 1374, 3021, 3083
BpmI CTGGAG 2 cut(s) 1167, 2792
Bpu10I CCTNAGC 2 cut(s) 3377, 3450
BpuEI CTTGAG 2 cut(s) 2495, 2684
BpuMI CCSGG 1 cut(s) 1550
BsaAI YACGTR 1 cut(s) 2312
BsaBI GATNNNNATC 1 cut(s) 2355
BsaHI GRCGYC 1 cut(s) 642
BsaI GGTCTC 1 cut(s) 1802
BsaWI WCCGGW 4 cut(s) 360, 550, 569, 1398
Bsc4I CCNNNNNNNGG 6 cut(s) 2043, 2193, 2479, 2653, 3043, 3437
Bse1I ACTGG 4 cut(s) 2156, 2603, 3296, 3524
Bse3DI GCAATG 2 cut(s) 1167, 3374
Bse8I GATNNNNATC 1 cut(s) 2355
BseBI CCWGG 5 cut(s) 2682, 3248, 3393, 3433, 3534
BseJI GATNNNNATC 1 cut(s) 2355
BseLI CCNNNNNNNGG 6 cut(s) 2043, 2193, 2479, 2653, 3043, 3437
BseMI GCAATG 2 cut(s) 1167, 3374
BseMII CTCAG 8 cut(s) 1057, 1210, 2843, 2876, 3008, 3329, 3391, 3441
BseNI ACTGG 4 cut(s) 2156, 2603, 3296, 3524
BseRI GAGGAG 5 cut(s) 382, 968, 2193, 2898, 2901
BseSI GKGCMC 3 cut(s) 299, 1195, 3038
BseYI CCCAGC 1 cut(s) 944
BsgI GTGCAG 4 cut(s) 449, 556, 693, 3610
Bsh1236I CGCG 3 cut(s) 994, 2417, 2916
Bsh1285I CGRYCG 1 cut(s) 118
BshFI GGCC 1 cut(s) 2282
BshNI GGYRCC 1 cut(s) 357
BsiEI CGRYCG 1 cut(s) 118
BsiHKAI GWGCWC 2 cut(s) 299, 3552
BsiHKCI CYCGRG 2 cut(s) 1819, 3631
BsiSI CCGG 5 cut(s) 361, 551, 570, 1399, 1549
BslFI GGGAC 4 cut(s) 1809, 2184, 3358, 3623
BslI CCNNNNNNNGG 6 cut(s) 2043, 2193, 2479, 2653, 3043, 3437
BsmAI GTCTC 6 cut(s) 824, 1802, 1895, 2752, 3532, 3665
BsmFI GGGAC 4 cut(s) 1809, 2184, 3358, 3623
BsmI GAATGC 3 cut(s) 1035, 1157, 1580
BsnI GGCC 1 cut(s) 2282
Bso31I GGTCTC 1 cut(s) 1802
BsoBI CYCGRG 2 cut(s) 1819, 3631
Bsp1286I GDGCHC 5 cut(s) 299, 770, 1195, 3038, 3552
Bsp1407I TGTACA 3 cut(s) 2124, 2556, 3321
Bsp19I CCATGG 4 cut(s) 606, 690, 1017, 2491
BspANI GGCC 1 cut(s) 2282
BspCNI CTCAG 8 cut(s) 1056, 1209, 2844, 2877, 3007, 3330, 3390, 3442
BspFNI CGCG 3 cut(s) 994, 2417, 2916
BspLI GGNNCC 7 cut(s) 78, 342, 359, 3245, 3374, 3538, 3700
BspPI GGATC 7 cut(s) 880, 1795, 1854, 2638, 2880, 3305, 3498
BspQI GCTCTTC 2 cut(s) 838, 2071
BspT107I GGYRCC 1 cut(s) 357
BspTI CTTAAG 1 cut(s) 2651
BspTNI GGTCTC 1 cut(s) 1802
BsrDI GCAATG 2 cut(s) 1167, 3374
BsrGI TGTACA 3 cut(s) 2124, 2556, 3321
BsrI ACTGG 4 cut(s) 2156, 2603, 3296, 3524
BssNI GRCGYC 1 cut(s) 642
BssT1I CCWWGG 4 cut(s) 606, 690, 1017, 2491
Bst2UI CCWGG 5 cut(s) 2682, 3248, 3393, 3433, 3534
Bst6I CTCTTC 7 cut(s) 16, 359, 838, 871, 1502, 2071, 2616
BstACI GRCGYC 1 cut(s) 642
BstAFI CTTAAG 1 cut(s) 2651
BstAUI TGTACA 3 cut(s) 2124, 2556, 3321
BstBAI YACGTR 1 cut(s) 2312
BstC8I GCNNGC 7 cut(s) 1033, 1499, 3034, 3548, 3641, 3645, 3649
BstDSI CCRYGG 5 cut(s) 44, 606, 690, 1017, 2491
BstENI CCTNNNNNAGG 1 cut(s) 2041
BstFNI CGCG 3 cut(s) 994, 2417, 2916
BstH2I RGCGCY 2 cut(s) 629, 3587
BstHHI GCGC 3 cut(s) 628, 3586, 3653
BstMAI GTCTC 6 cut(s) 824, 1802, 1895, 2752, 3532, 3665
BstMCI CGRYCG 1 cut(s) 118
BstNI CCWGG 5 cut(s) 2682, 3248, 3393, 3433, 3534
BstNSI RCATGY 4 cut(s) 704, 1007, 2131, 3348
BstSCI CCNGG 6 cut(s) 1548, 2680, 3246, 3391, 3431, 3532
BstSFI CTRYAG 3 cut(s) 1950, 2338, 2722
BstSLI GKGCMC 3 cut(s) 299, 1195, 3038
BstSNI TACGTA 1 cut(s) 2312
BstUI CGCG 3 cut(s) 994, 2417, 2916
BstV2I GAAGAC 3 cut(s) 1374, 3021, 3083
BstX2I RGATCY 5 cut(s) 160, 885, 1800, 1846, 2872
BstXI CCANNNNNNTGG 2 cut(s) 1702, 1744
BstYI RGATCY 5 cut(s) 160, 885, 1800, 1846, 2872
BsuI GTATCC 4 cut(s) 472, 769, 1546, 3471
BsuRI GGCC 1 cut(s) 2282
BtgI CCRYGG 5 cut(s) 44, 606, 690, 1017, 2491
BtgZI GCGATG 2 cut(s) 3737, 3758
BtsI GCAGTG 2 cut(s) 645, 3069
BtsIMutI CAGTG 8 cut(s) 645, 1476, 2065, 2610, 2882, 3002, 3069, 3559
Cac8I GCNNGC 7 cut(s) 1033, 1499, 3034, 3548, 3641, 3645, 3649
CaiI CAGNNNCTG 1 cut(s) 3384
CfoI GCGC 3 cut(s) 628, 3586, 3653
Cfr13I GGNCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
CseI GACGC 2 cut(s) 2888, 3323
Csp6I GTAC 8 cut(s) 1480, 2125, 2391, 2557, 2753, 3130, 3322, 3342
CspCI CAANNNNNGTGG 2 cut(s) 706, 741
CviQI GTAC 8 cut(s) 1480, 2125, 2391, 2557, 2753, 3130, 3322, 3342
DraI TTTAAA 1 cut(s) 2787
DrdI GACNNNNNNGTC 1 cut(s) 3596
DriI GACNNNNNGTC 1 cut(s) 1333
DseDI GACNNNNNNGTC 1 cut(s) 3596
Eam1104I CTCTTC 7 cut(s) 16, 359, 838, 871, 1502, 2071, 2616
Eam1105I GACNNNNNGTC 1 cut(s) 1333
EarI CTCTTC 7 cut(s) 16, 359, 838, 871, 1502, 2071, 2616
Eco105I TACGTA 1 cut(s) 2312
Eco130I CCWWGG 4 cut(s) 606, 690, 1017, 2491
Eco24I GRGCYC 1 cut(s) 770
Eco31I GGTCTC 1 cut(s) 1802
Eco32I GATATC 1 cut(s) 2097
Eco47I GGWCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
Eco47III AGCGCT 1 cut(s) 627
Eco57I CTGAAG 1 cut(s) 1985
Eco88I CYCGRG 2 cut(s) 1819, 3631
EcoNI CCTNNNNNAGG 1 cut(s) 2041
EcoO109I RGGNCCY 1 cut(s) 77
EcoRI GAATTC 2 cut(s) 1514, 3728
EcoRII CCWGG 5 cut(s) 2680, 3246, 3391, 3431, 3532
EcoRV GATATC 1 cut(s) 2097
EcoT14I CCWWGG 4 cut(s) 606, 690, 1017, 2491
EcoT22I ATGCAT 2 cut(s) 1539, 2865
EcoT38I GRGCYC 1 cut(s) 770
ErhI CCWWGG 4 cut(s) 606, 690, 1017, 2491
FalI AAGNNNNNCTT 4 cut(s) 1084, 1116, 1325, 1357
FaqI GGGAC 4 cut(s) 1809, 2184, 3358, 3623
FauI CCCGC 3 cut(s) 817, 1148, 2124
FauNDI CATATG 1 cut(s) 2894
FbaI TGATCA 1 cut(s) 3004
FblI GTMKAC 5 cut(s) 566, 660, 1162, 1690, 1732
FriOI GRGCYC 1 cut(s) 770
FspBI CTAG 9 cut(s) 462, 852, 1083, 1241, 1494, 1860, 2780, 2876, 3446
FspI TGCGCA 1 cut(s) 3652
GlaI GCGC 3 cut(s) 627, 3585, 3652
GsaI CCCAGC 1 cut(s) 948
GsuI CTGGAG 2 cut(s) 1167, 2792
HaeII RGCGCY 2 cut(s) 629, 3587
HaeIII GGCC 1 cut(s) 2282
HapII CCGG 5 cut(s) 361, 551, 570, 1399, 1549
HgaI GACGC 2 cut(s) 2888, 3323
HhaI GCGC 3 cut(s) 628, 3586, 3653
Hin1I GRCGYC 1 cut(s) 642
Hin6I GCGC 3 cut(s) 626, 3584, 3651
HinP1I GCGC 3 cut(s) 626, 3584, 3651
HindIII AAGCTT 4 cut(s) 381, 1908, 1970, 3480
HpaII CCGG 5 cut(s) 361, 551, 570, 1399, 1549
HphI GGTGA 4 cut(s) 979, 1612, 2431, 2681
Hpy99I CGWCG 2 cut(s) 644, 953
HpyCH4IV ACGT 2 cut(s) 642, 2311
HpySE526I ACGT 2 cut(s) 642, 2311
Hsp92I GRCGYC 1 cut(s) 642
HspAI GCGC 3 cut(s) 626, 3584, 3651
Ksp22I TGATCA 1 cut(s) 3004
LguI GCTCTTC 2 cut(s) 838, 2071
LmnI GCTCC 4 cut(s) 955, 3243, 3536, 3698
LweI GCATC 9 cut(s) 425, 433, 1270, 1524, 2242, 2524, 2719, 2810, 2850
MaeI CTAG 9 cut(s) 462, 852, 1083, 1241, 1494, 1860, 2780, 2876, 3446
MaeII ACGT 2 cut(s) 642, 2311
MfeI CAATTG 4 cut(s) 204, 1407, 3008, 3465
MflI RGATCY 5 cut(s) 160, 885, 1800, 1846, 2872
MhlI GDGCHC 5 cut(s) 299, 770, 1195, 3038, 3552
MlyI GAGTC 2 cut(s) 1831, 2938
MmeI TCCRAC 3 cut(s) 219, 2850, 3325
Mph1103I ATGCAT 2 cut(s) 1539, 2865
MseI TTAA 6 cut(s) 138, 630, 1835, 2652, 2786, 2934
MspA1I CMGCKG 3 cut(s) 433, 2955, 3689
MspCI CTTAAG 1 cut(s) 2651
MspI CCGG 5 cut(s) 361, 551, 570, 1399, 1549
MspR9I CCNGG 6 cut(s) 1550, 2682, 3248, 3393, 3433, 3534
MunI CAATTG 4 cut(s) 204, 1407, 3008, 3465
Mva1269I GAATGC 3 cut(s) 1035, 1157, 1580
MvaI CCWGG 5 cut(s) 2682, 3248, 3393, 3433, 3534
MvnI CGCG 3 cut(s) 994, 2417, 2916
NciI CCSGG 1 cut(s) 1550
NcoI CCATGG 4 cut(s) 606, 690, 1017, 2491
NdeI CATATG 1 cut(s) 2894
NlaIV GGNNCC 7 cut(s) 78, 342, 359, 3245, 3374, 3538, 3700
NmeAIII GCCGAG 1 cut(s) 2040
NmuCI GTSAC 6 cut(s) 643, 2074, 2419, 2468, 3494, 3603
NsbI TGCGCA 1 cut(s) 3652
NsiI ATGCAT 2 cut(s) 1539, 2865
NspI RCATGY 4 cut(s) 704, 1007, 2131, 3348
PasI CCCWGGG 1 cut(s) 3432
PciI ACATGT 2 cut(s) 700, 3344
PciSI GCTCTTC 2 cut(s) 838, 2071
PctI GAATGC 3 cut(s) 1035, 1157, 1580
PflFI GACNNNGTC 1 cut(s) 641
PfoI TCCNGGA 1 cut(s) 1548
Ple19I CGATCG 1 cut(s) 118
PleI GAGTC 2 cut(s) 1830, 2937
PpsI GAGTC 2 cut(s) 1830, 2937
Ppu21I YACGTR 1 cut(s) 2312
PpuMI RGGWCCY 1 cut(s) 77
PscI ACATGT 2 cut(s) 700, 3344
PshBI ATTAAT 1 cut(s) 1835
PsiI TTATAA 2 cut(s) 893, 1125
Psp5II RGGWCCY 1 cut(s) 77
Psp6I CCWGG 5 cut(s) 2680, 3246, 3391, 3431, 3532
PspFI CCCAGC 1 cut(s) 944
PspGI CCWGG 5 cut(s) 2680, 3246, 3391, 3431, 3532
PspN4I GGNNCC 7 cut(s) 78, 342, 359, 3245, 3374, 3538, 3700
PspPI GGNCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
PspPPI RGGWCCY 1 cut(s) 77
PstNI CAGNNNCTG 1 cut(s) 3384
PsuI RGATCY 5 cut(s) 160, 885, 1800, 1846, 2872
PsyI GACNNNGTC 1 cut(s) 641
PvuI CGATCG 1 cut(s) 118
PvuII CAGCTG 1 cut(s) 3689
RsaI GTAC 8 cut(s) 1481, 2126, 2392, 2558, 2754, 3131, 3323, 3343
RsaNI GTAC 8 cut(s) 1480, 2125, 2391, 2557, 2753, 3130, 3322, 3342
SapI GCTCTTC 2 cut(s) 838, 2071
SaqAI TTAA 6 cut(s) 138, 630, 1835, 2652, 2786, 2934
Sau96I GGNCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
SchI GAGTC 2 cut(s) 1831, 2938
ScrFI CCNGG 6 cut(s) 1550, 2682, 3248, 3393, 3433, 3534
SduI GDGCHC 5 cut(s) 299, 770, 1195, 3038, 3552
SfaNI GCATC 9 cut(s) 425, 433, 1270, 1524, 2242, 2524, 2719, 2810, 2850
SfcI CTRYAG 3 cut(s) 1950, 2338, 2722
SinI GGWCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
SmlI CTYRAG 3 cut(s) 2510, 2651, 2699
SmoI CTYRAG 3 cut(s) 2510, 2651, 2699
SnaBI TACGTA 1 cut(s) 2312
SpeI ACTAGT 1 cut(s) 1859
SspI AATATT 1 cut(s) 2191
SspMI CTAG 9 cut(s) 462, 852, 1083, 1241, 1494, 1860, 2780, 2876, 3446
StyD4I CCNGG 6 cut(s) 1548, 2680, 3246, 3391, 3431, 3532
StyI CCWWGG 4 cut(s) 606, 690, 1017, 2491
TaiI ACGT 2 cut(s) 645, 2314
TaqI TCGA 5 cut(s) 88, 387, 1636, 2344, 3726
TatI WGTACW 4 cut(s) 2124, 2556, 3321, 3341
Tru1I TTAA 6 cut(s) 138, 630, 1835, 2652, 2786, 2934
Tru9I TTAA 6 cut(s) 138, 630, 1835, 2652, 2786, 2934
TscAI CASTG 8 cut(s) 652, 1476, 2065, 2610, 2889, 3002, 3069, 3566
TseFI GTSAC 6 cut(s) 643, 2074, 2419, 2468, 3494, 3603
Tsp45I GTSAC 6 cut(s) 643, 2074, 2419, 2468, 3494, 3603
TspGWI ACGGA 5 cut(s) 33, 314, 678, 878, 2814
TspRI CASTG 8 cut(s) 652, 1476, 2065, 2610, 2889, 3002, 3069, 3566
Tth111I GACNNNGTC 1 cut(s) 641
Vha464I CTTAAG 1 cut(s) 2651
VneI GTGCAC 1 cut(s) 295
VpaK11BI GGWCC 6 cut(s) 77, 340, 2600, 2903, 3353, 3372
VspI ATTAAT 1 cut(s) 1835
XagI CCTNNNNNAGG 1 cut(s) 2041
XbaI TCTAGA 1 cut(s) 2875
XceI RCATGY 4 cut(s) 704, 1007, 2131, 3348
XmiI GTMKAC 5 cut(s) 566, 660, 1162, 1690, 1732
XspI CTAG 9 cut(s) 462, 852, 1083, 1241, 1494, 1860, 2780, 2876, 3446
ZraI GACGTC 1 cut(s) 643
Zsp2I ATGCAT 2 cut(s) 1539, 2865
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.