FvH4_6g10171

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000691
Physical Location & Seq
Forward (+)
6053620 .. 6053991
372 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g10171.t1

Sequence Viewer

Length: 231 bp
ATGTTTATTATAGGTGAAGAACCATCTGCTCCAGGGACGACAAAGTTGCCCAAGAGTTTATACACAACAATCACATGTGGGATATGTCATAAGAAATGCCACAACAGGAGGAGTTGTGAAAGAAGAAACCAGCAACAAGTGCCAGATGTGAATGTTGAAGTTCCAAATGAGAACATTGAAGTTCCTGTCGACAACAATGTCGAAACCCCTACTGATCCTACCACTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

77

Amino Acids

8.49

Weight (kDa)

5.57

Isoelectric Point (pI)

82.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 197
AccI GTMKAC 1 cut(s) 189
AclWI GGATC 1 cut(s) 209
AflIII ACRYGT 1 cut(s) 74
AgsI TTSAA 2 cut(s) 158, 179
AjnI CCWGG 1 cut(s) 31
AlwI GGATC 1 cut(s) 209
AsuHPI GGTGA 1 cut(s) 26
BccI CCATC 1 cut(s) 31
BcgI CGANNNNNNTGC 2 cut(s) 28, 62
BciT130I CCWGG 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BpmI CTGGAG 1 cut(s) 15
BsaJI CCNNGG 1 cut(s) 32
BsaXI ACNNNNNCTCC 2 cut(s) 100, 130
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 124
BslFI GGGAC 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 214
BspPI GGATC 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 226
BstAPI GCANNNNNTGC 1 cut(s) 139
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 222
CviAII CATG 1 cut(s) 75
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
DrdI GACNNNNNNGTC 1 cut(s) 197
DseDI GACNNNNNNGTC 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 1 cut(s) 78
FaiI YATR 5 cut(s) 11, 61, 76, 85, 90
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 74
FblI GTMKAC 1 cut(s) 189
GsuI CTGGAG 1 cut(s) 15
Hin1II CATG 1 cut(s) 78
HincII GTYRAC 1 cut(s) 190
HindII GTYRAC 1 cut(s) 190
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 190
Hpy8I GTNNAC 1 cut(s) 190
HpyCH4III ACNGT 1 cut(s) 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
Hsp92II CATG 1 cut(s) 78
Kzo9I GATC 1 cut(s) 214
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 6 cut(s) 18, 45, 91, 143, 156, 198
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 2 cut(s) 29, 135
MnlI CCTC 1 cut(s) 102
MseI TTAA 1 cut(s) 229
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 139
NdeII GATC 1 cut(s) 214
NlaIII CATG 1 cut(s) 78
NspI RCATGY 1 cut(s) 78
PciI ACATGT 1 cut(s) 74
PscI ACATGT 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
SalI GTCGAC 1 cut(s) 188
SaqAI TTAA 1 cut(s) 229
Sau3AI GATC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 33
SetI ASST 1 cut(s) 16
SgeI CNNG 9 cut(s) 44, 45, 64, 87, 118, 142, 149, 155, 197
StyD4I CCNGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 226
TaqI TCGA 2 cut(s) 189, 201
Tru1I TTAA 1 cut(s) 229
Tru9I TTAA 1 cut(s) 229
TscAI CASTG 1 cut(s) 229
TspRI CASTG 1 cut(s) 229
XceI RCATGY 1 cut(s) 78
XmiI GTMKAC 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.