Rmu_ssc0000255.1_g000048

SAM dependent carboxyl methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000255.1
OG0000691
Physical Location & Seq
Reverse (-)
286039 .. 286824
786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000255.1_g000048.1.cds

Sequence Viewer

Length: 468 bp
atgaggcctgatgattttgtgcatgaatacttcaccaaggacacctatatgaaggcatatgagcttattttgttcccaatagctggagtggttgagtgggacaagatacataggcccattgcacctcttctttataggaggcaacctgggaggcccaaaatgtcaaggaacaaggaacctgtagtcccaccaactggagcagagaagttgcctaaaatttattaccaacaggtcacttgtggaatatgtaggaagaagggccacaataagagaaccttcaagcaaggtgagaatatgcagcagcaccaggaagatgaggcagtgcagcagccagaaaatgaggaaattgctacagcttcaggcagctcctccagtactggtttcacaaccagaaggttcaaagtgcttgctaatagaaaacctagaccagcaaatccccctccgttagcaaacaatgaatctgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00592 ko01110 map00592 map01110
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

155

Amino Acids

17.82

Weight (kDa)

9.49

Isoelectric Point (pI)

61.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 83, 194
AcsI RAATTY 1 cut(s) 216
AcuI CTGAAG 1 cut(s) 342
AfaI GTAC 1 cut(s) 376
AfiI CCNNNNNNNGG 2 cut(s) 83, 194
AgsI TTSAA 2 cut(s) 280, 400
AjnI CCWGG 2 cut(s) 145, 306
AloI GAACNNNNNNTCC 2 cut(s) 168, 200
AluBI AGCT 4 cut(s) 64, 83, 356, 366
AluI AGCT 4 cut(s) 64, 83, 356, 366
AoxI GGCC 4 cut(s) 5, 113, 152, 259
ApeKI GCWGC 5 cut(s) 298, 301, 325, 328, 363
ApoI RAATTY 1 cut(s) 216
AspS9I GGNCC 3 cut(s) 114, 153, 259
AsuHPI GGTGA 2 cut(s) 25, 299
BbvI GCAGC 5 cut(s) 310, 313, 337, 340, 375
BciT130I CCWGG 2 cut(s) 147, 308
BfaI CTAG 1 cut(s) 423
BfmI CTRYAG 2 cut(s) 180, 351
BisI GCNGC 5 cut(s) 299, 302, 326, 329, 364
BlsI GCNGC 5 cut(s) 300, 303, 327, 330, 365
BmcAI AGTACT 1 cut(s) 376
Bme1390I CCNGG 2 cut(s) 147, 308
BmgT120I GGNCC 3 cut(s) 114, 153, 259
BmiI GGNNCC 1 cut(s) 177
BmrFI CCNGG 2 cut(s) 147, 308
BpmI CTGGAG 3 cut(s) 105, 216, 355
BsaJI CCNNGG 2 cut(s) 36, 146
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 194
Bse1I ACTGG 3 cut(s) 199, 372, 382
Bse3DI GCAATG 1 cut(s) 117
BseBI CCWGG 2 cut(s) 147, 308
BseDI CCNNGG 2 cut(s) 36, 146
BseLI CCNNNNNNNGG 2 cut(s) 83, 194
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 3 cut(s) 199, 372, 382
BseRI GAGGAG 1 cut(s) 358
BseXI GCAGC 5 cut(s) 310, 313, 337, 340, 375
BsgI GTGCAG 1 cut(s) 344
BshFI GGCC 4 cut(s) 7, 115, 154, 261
BslFI GGGAC 2 cut(s) 113, 170
BslI CCNNNNNNNGG 2 cut(s) 83, 194
BsmFI GGGAC 2 cut(s) 113, 170
BsnI GGCC 4 cut(s) 7, 115, 154, 261
BspANI GGCC 4 cut(s) 7, 115, 154, 261
BspLI GGNNCC 1 cut(s) 177
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 3 cut(s) 199, 372, 382
BssECI CCNNGG 2 cut(s) 36, 146
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 2 cut(s) 147, 308
Bst6I CTCTTC 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 408
BstNI CCWGG 2 cut(s) 147, 308
BstSCI CCNGG 2 cut(s) 145, 306
BstSFI CTRYAG 2 cut(s) 180, 351
BstV1I GCAGC 5 cut(s) 310, 313, 337, 340, 375
BsuRI GGCC 4 cut(s) 7, 115, 154, 261
BtsI GCAGTG 1 cut(s) 327
BtsIMutI CAGTG 1 cut(s) 327
Cac8I GCNNGC 1 cut(s) 408
Cfr13I GGNCC 3 cut(s) 114, 153, 259
Csp6I GTAC 1 cut(s) 375
CviAII CATG 1 cut(s) 23
CviJI RGCY 9 cut(s) 7, 64, 83, 115, 154, 261, 331, 356, 366
CviKI_1 RGCY 9 cut(s) 7, 64, 83, 115, 154, 261, 331, 356, 366
CviQI GTAC 1 cut(s) 375
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 36
Eco147I AGGCCT 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 342
EcoRII CCWGG 2 cut(s) 145, 306
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 26
FaiI YATR 9 cut(s) 24, 48, 50, 58, 60, 111, 135, 247, 296
FalI AAGNNNNNCTT 2 cut(s) 260, 292
FaqI GGGAC 2 cut(s) 113, 170
FatI CATG 1 cut(s) 22
FauNDI CATATG 1 cut(s) 58
Fnu4HI GCNGC 5 cut(s) 299, 302, 326, 329, 364
Fsp4HI GCNGC 5 cut(s) 299, 302, 326, 329, 364
FspBI CTAG 1 cut(s) 423
GluI GCNGC 5 cut(s) 299, 302, 326, 329, 364
GsuI CTGGAG 3 cut(s) 105, 216, 355
HaeIII GGCC 4 cut(s) 7, 115, 154, 261
Hin1II CATG 1 cut(s) 26
HinfI GANTC 1 cut(s) 458
HphI GGTGA 2 cut(s) 25, 299
Hpy188I TCNGA 1 cut(s) 463
HpyAV CCTTC 4 cut(s) 46, 250, 286, 387
HpyCH4V TGCA 4 cut(s) 22, 122, 298, 325
Hsp92II CATG 1 cut(s) 26
LmnI GCTCC 2 cut(s) 197, 371
Lsp1109I GCAGC 5 cut(s) 310, 313, 337, 340, 375
MaeI CTAG 1 cut(s) 423
MaeIII GTNAC 1 cut(s) 232
MboII GAAGA 3 cut(s) 119, 265, 323
MluCI AATT 2 cut(s) 216, 345
MnlI CCTC 7 cut(s) 132, 135, 144, 310, 334, 379, 450
MslI CAYNNNNRTG 1 cut(s) 47
MspR9I CCNGG 2 cut(s) 147, 308
MvaI CCWGG 2 cut(s) 147, 308
NdeI CATATG 1 cut(s) 58
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 232
PceI AGGCCT 1 cut(s) 7
PfeI GAWTC 1 cut(s) 458
PflMI CCANNNNNTGG 2 cut(s) 83, 194
PkrI GCNGC 5 cut(s) 300, 303, 327, 330, 365
Psp6I CCWGG 2 cut(s) 145, 306
PspGI CCWGG 2 cut(s) 145, 306
PspN4I GGNNCC 1 cut(s) 177
PspPI GGNCC 3 cut(s) 114, 153, 259
RsaI GTAC 1 cut(s) 376
RsaNI GTAC 1 cut(s) 375
RseI CAYNNNNRTG 1 cut(s) 47
SatI GCNGC 5 cut(s) 299, 302, 326, 329, 364
Sau96I GGNCC 3 cut(s) 114, 153, 259
ScaI AGTACT 1 cut(s) 376
ScrFI CCNGG 2 cut(s) 147, 308
SfcI CTRYAG 2 cut(s) 180, 351
SmiMI CAYNNNNRTG 1 cut(s) 47
Sse9I AATT 2 cut(s) 216, 345
SseBI AGGCCT 1 cut(s) 7
SspMI CTAG 1 cut(s) 423
StuI AGGCCT 1 cut(s) 7
StyD4I CCNGG 2 cut(s) 145, 306
StyI CCWWGG 1 cut(s) 36
TasI AATT 2 cut(s) 216, 345
TatI WGTACW 1 cut(s) 374
TfiI GAWTC 1 cut(s) 458
TscAI CASTG 1 cut(s) 327
TseFI GTSAC 1 cut(s) 232
TseI GCWGC 5 cut(s) 298, 301, 325, 328, 363
Tsp45I GTSAC 1 cut(s) 232
TspDTI ATGAA 2 cut(s) 39, 65
TspGWI ACGGA 1 cut(s) 432
TspRI CASTG 1 cut(s) 327
Van91I CCANNNNNTGG 2 cut(s) 83, 194
XapI RAATTY 1 cut(s) 216
XspI CTAG 1 cut(s) 423
ZrmI AGTACT 1 cut(s) 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.