Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0000691

Physical Location & Seq

Genomic Coordinates Reverse (-)

67544969 .. 67548306

Gene Structure 3338 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00276260.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGGTGAAGACTTTCTGCCAATTAGGGATGAAAAAGAAGTTAAACAATCCTGAAGACTTTGTTGATGAGTGTTATTCTCAAAAAAAGTACATGGAAGCTTATGAACTGGCTATCAACCCAATTCCAAGAGTTGCTGAATGGGAATTGATTAACAAGCCCATCATGCCTCCAAGATACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00592 ko01110 map00592 map01110

Pfam Domains

Protein Families

Methyltransf_7

Protein Analysis

59

Amino Acids

7.05

Weight (kDa)

7.73

Isoelectric Point (pI)

33.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000691)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g09131 FvH4_5g29241 FvH4_5g38700 FvH4_6g10171 FvH4_6g31671 FvH4_7g25602
rosa_chinensis	RchiOBHm_Chr3g0477061 RchiOBHm_Chr5g0037961 RchiOBHm_Chr5g0045201 RchiOBHm_Chr5g0075681 RchiOBHm_Chr6g0255251 RchiOBHm_Chr6g0276481 RchiOBHm_Chr7g0188661 RchiOBHm_Chr7g0212591
rosa_laevigata	RLG00000014285 RLG00000019737 RLG00000020231 RLG00000027687 RLG00000028530 RLG00000029679
rosa_multiflora	Rmu_sc0008577.1_g000011 Rmu_sc0010616.1_g000005 Rmu_ssc0000255.1_g000048
rosa_roxburghii	Rroxscaffold_1G00039250 Rroxscaffold_2G00087850 Rroxscaffold_3G00231610 Rroxscaffold_3G00276260 Rroxscaffold_3G00276270
rosa_rugosa	Rorug01G0345200.1 Rorug02G0070900 Rorug03G0279300
rosa_samantha	Rh1AG087400 Rh1AG177300 Rh1BG218300 Rh1CG085600 Rh1CG164600 Rh1CG231700 Rh1CG234900 Rh1DG092000 Rh1DG244700 Rh3AG293200 Rh3BG241800 Rh3CG102600 Rh3CG163100 Rh3CG278400 Rh3DG163700 Rh3DG208200 Rh4AG190800 Rh4DG072100 Rh5AG271800 Rh5BG011900 Rh5BG311500 Rh5CG245000 Rh5CG402400 Rh5DG009700 Rh5DG321700 Rh6BG065700 Rh6BG431400 Rh6CG449000 Rh6DG208800 Rh7AG267300 Rh7BG437400 Rh7CG285800 Rh7CG418900 Rh7CG450100 Rh7DG275300
rosa_wichuraiana	Rw0G005630 Rw0G009300 Rw0G023360 Rw1G017030 Rw1G017050 Rw4G035810 Rw6G031650 Rw7G008390 Rw7G022990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	72
AfaI	GTAC	1 cut(s)	89
AluBI	AGCT	1 cut(s)	98
AluI	AGCT	1 cut(s)	98
Asp700I	GAANNNNTTC	1 cut(s)	11
AsuHPI	GGTGA	1 cut(s)	16
BbsI	GAAGAC	2 cut(s)	14, 60
BccI	CCATC	1 cut(s)	167
BfaI	CTAG	1 cut(s)	178
BpiI	GAAGAC	2 cut(s)	14, 60
Bse1I	ACTGG	1 cut(s)	111
BseGI	GGATG	1 cut(s)	33
BseNI	ACTGG	1 cut(s)	111
BsrI	ACTGG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	33
BstMWI	GCNNNNNNNGC	1 cut(s)	163
BstV2I	GAAGAC	2 cut(s)	14, 60
BtsCI	GGATG	1 cut(s)	33
Csp6I	GTAC	1 cut(s)	88
CviAII	CATG	2 cut(s)	91, 163
CviJI	RGCY	3 cut(s)	98, 110, 157
CviKI_1	RGCY	3 cut(s)	98, 110, 157
CviQI	GTAC	1 cut(s)	88
Eco57I	CTGAAG	1 cut(s)	72
FaeI	CATG	2 cut(s)	94, 166
FaiI	YATR	3 cut(s)	92, 102, 164
FatI	CATG	2 cut(s)	90, 162
FokI	GGATG	1 cut(s)	40
FspBI	CTAG	1 cut(s)	178
Hin1II	CATG	2 cut(s)	94, 166
HindIII	AAGCTT	1 cut(s)	96
HphI	GGTGA	1 cut(s)	16
Hpy188III	TCNNGA	1 cut(s)	50
HpyF10VI	GCNNNNNNNGC	1 cut(s)	163
Hsp92II	CATG	2 cut(s)	94, 166
LpnPI	CCDG	2 cut(s)	63, 92
MaeI	CTAG	1 cut(s)	178
MboII	GAAGA	2 cut(s)	19, 65
MluCI	AATT	3 cut(s)	20, 120, 143
MnlI	CCTC	1 cut(s)	177
MroXI	GAANNNNTTC	1 cut(s)	11
MseI	TTAA	2 cut(s)	41, 150
MwoI	GCNNNNNNNGC	1 cut(s)	163
NlaIII	CATG	2 cut(s)	94, 166
PdmI	GAANNNNTTC	1 cut(s)	11
RsaI	GTAC	1 cut(s)	89
RsaNI	GTAC	1 cut(s)	88
SaqAI	TTAA	2 cut(s)	41, 150
SetI	ASST	1 cut(s)	100
SgeI	CNNG	6 cut(s)	62, 103, 119, 138, 166, 175
Sse9I	AATT	3 cut(s)	20, 120, 143
SspMI	CTAG	1 cut(s)	178
TasI	AATT	3 cut(s)	20, 120, 143
TatI	WGTACW	1 cut(s)	87
Tru1I	TTAA	2 cut(s)	41, 150
Tru9I	TTAA	2 cut(s)	41, 150
TspDTI	ATGAA	2 cut(s)	44, 117
XmnI	GAANNNNTTC	1 cut(s)	11
XspI	CTAG	1 cut(s)	178

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.