Rw1G017030

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000691
Physical Location & Seq
Forward (+)
37804196 .. 37805178
983 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G017030.1

Sequence Viewer

Length: 372 bp
ATGCTTGCATATGGTCCAGCCATAAACCCAATTCCTGGTTACACTAAAGGACCTGGAAGGCCTAAATTCTCAAGAAACAAAGAACCAGATGAGCAACGTCTACCACCTCCTGGAACCACTAAGCCACCTTCTGGAACTGAGAAGTTACCAAGGGCTTACTATCAAGGAATTACATGTGGACGACGCCATAAGAAAGGGCATAATAGCATAACTTGTGCAAGAAGAGAAGCACAGTCCCAAACAAGGATTGAATCACCACCTTCTCAAAACTATGGAAATGATATGCATGTTGATCAAGCTTCACATGATGACAATCAAATACCTATGAGAATTCAGCGCAACAAAGCCCCTGCACCAAATGAAAGATCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.74

Weight (kDa)

9.95

Isoelectric Point (pI)

68.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 35, 110, 131
AccI GTMKAC 1 cut(s) 100
AcsI RAATTY 2 cut(s) 65, 330
AcyI GRCGYC 1 cut(s) 184
AfiI CCNNNNNNNGG 4 cut(s) 35, 110, 131, 243
AflIII ACRYGT 1 cut(s) 173
AgsI TTSAA 1 cut(s) 251
AjnI CCWGG 3 cut(s) 34, 52, 109
AluBI AGCT 1 cut(s) 299
AluI AGCT 1 cut(s) 299
AoxI GGCC 1 cut(s) 59
ApoI RAATTY 2 cut(s) 65, 330
AspLEI GCGC 1 cut(s) 339
AspS9I GGNCC 2 cut(s) 14, 50
AsuHPI GGTGA 1 cut(s) 246
AvaII GGWCC 2 cut(s) 14, 50
BciT130I CCWGG 3 cut(s) 36, 54, 111
BclI TGATCA 1 cut(s) 292
BglII AGATCT 1 cut(s) 365
Bme1390I CCNGG 3 cut(s) 36, 54, 111
Bme18I GGWCC 2 cut(s) 14, 50
BmgT120I GGNCC 2 cut(s) 14, 50
BmiI GGNNCC 1 cut(s) 115
BmrFI CCNGG 3 cut(s) 36, 54, 111
BpuEI CTTGAG 1 cut(s) 55
BsaBI GATNNNNATC 1 cut(s) 312
BsaHI GRCGYC 1 cut(s) 184
BsaJI CCNNGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 4 cut(s) 35, 110, 131, 243
Bse8I GATNNNNATC 1 cut(s) 312
BseBI CCWGG 3 cut(s) 36, 54, 111
BseDI CCNNGG 1 cut(s) 149
BseJI GATNNNNATC 1 cut(s) 312
BseLI CCNNNNNNNGG 4 cut(s) 35, 110, 131, 243
BseMII CTCAG 1 cut(s) 129
BsgI GTGCAG 1 cut(s) 336
BshFI GGCC 1 cut(s) 61
BslFI GGGAC 1 cut(s) 220
BslI CCNNNNNNNGG 4 cut(s) 35, 110, 131, 243
BsmFI GGGAC 1 cut(s) 220
BsnI GGCC 1 cut(s) 61
Bsp143I GATC 2 cut(s) 292, 365
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 2 cut(s) 292, 365
BssNI GRCGYC 1 cut(s) 184
BssT1I CCWWGG 1 cut(s) 149
Bst2UI CCWGG 3 cut(s) 36, 54, 111
Bst4CI ACNGT 1 cut(s) 234
Bst6I CTCTTC 1 cut(s) 217
BstACI GRCGYC 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 3 cut(s) 120, 138, 369
BstHHI GCGC 1 cut(s) 339
BstKTI GATC 2 cut(s) 295, 368
BstMBI GATC 2 cut(s) 292, 365
BstNI CCWGG 3 cut(s) 36, 54, 111
BstNSI RCATGY 2 cut(s) 177, 290
BstSCI CCNGG 3 cut(s) 34, 52, 109
BstX2I RGATCY 1 cut(s) 365
BstYI RGATCY 1 cut(s) 365
BsuRI GGCC 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 6
CfoI GCGC 1 cut(s) 339
Cfr13I GGNCC 2 cut(s) 14, 50
CseI GACGC 1 cut(s) 192
CviAII CATG 3 cut(s) 174, 287, 305
CviJI RGCY 6 cut(s) 20, 61, 124, 155, 299, 347
CviKI_1 RGCY 6 cut(s) 20, 61, 124, 155, 299, 347
DdeI CTNAG 3 cut(s) 120, 138, 369
DpnI GATC 2 cut(s) 294, 367
DpnII GATC 2 cut(s) 292, 365
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 149
Eco147I AGGCCT 1 cut(s) 61
Eco47I GGWCC 2 cut(s) 14, 50
EcoO109I RGGNCCY 1 cut(s) 50
EcoRI GAATTC 1 cut(s) 330
EcoRII CCWGG 3 cut(s) 34, 52, 109
EcoT14I CCWWGG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 288
ErhI CCWWGG 1 cut(s) 149
FaeI CATG 3 cut(s) 177, 290, 308
FaqI GGGAC 1 cut(s) 220
FatI CATG 3 cut(s) 173, 286, 304
FauNDI CATATG 1 cut(s) 10
FbaI TGATCA 1 cut(s) 292
FblI GTMKAC 1 cut(s) 100
GlaI GCGC 1 cut(s) 338
HaeIII GGCC 1 cut(s) 61
HgaI GACGC 1 cut(s) 192
HhaI GCGC 1 cut(s) 339
Hin1I GRCGYC 1 cut(s) 184
Hin1II CATG 3 cut(s) 177, 290, 308
Hin6I GCGC 1 cut(s) 337
HinP1I GCGC 1 cut(s) 337
HindIII AAGCTT 1 cut(s) 297
HinfI GANTC 1 cut(s) 251
HphI GGTGA 1 cut(s) 246
Hpy166II GTNNAC 2 cut(s) 101, 179
Hpy188III TCNNGA 2 cut(s) 72, 132
Hpy8I GTNNAC 2 cut(s) 101, 179
Hpy99I CGWCG 1 cut(s) 186
HpyAV CCTTC 3 cut(s) 51, 138, 270
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4IV ACGT 1 cut(s) 97
HpyCH4V TGCA 4 cut(s) 8, 218, 286, 353
HpyF3I CTNAG 3 cut(s) 120, 138, 369
HpySE526I ACGT 1 cut(s) 97
Hsp92I GRCGYC 1 cut(s) 184
Hsp92II CATG 3 cut(s) 177, 290, 308
HspAI GCGC 1 cut(s) 337
Ksp22I TGATCA 1 cut(s) 292
Kzo9I GATC 2 cut(s) 292, 365
MaeII ACGT 1 cut(s) 97
MaeIII GTNAC 2 cut(s) 38, 144
MalI GATC 2 cut(s) 294, 367
MboI GATC 2 cut(s) 292, 365
MboII GAAGA 1 cut(s) 234
MflI RGATCY 1 cut(s) 365
MluCI AATT 4 cut(s) 30, 65, 168, 330
MnlI CCTC 1 cut(s) 117
Mph1103I ATGCAT 1 cut(s) 288
MspR9I CCNGG 3 cut(s) 36, 54, 111
MvaI CCWGG 3 cut(s) 36, 54, 111
NdeI CATATG 1 cut(s) 10
NdeII GATC 2 cut(s) 292, 365
NlaIII CATG 3 cut(s) 177, 290, 308
NlaIV GGNNCC 1 cut(s) 115
NsiI ATGCAT 1 cut(s) 288
NspI RCATGY 2 cut(s) 177, 290
PceI AGGCCT 1 cut(s) 61
PciI ACATGT 1 cut(s) 173
PfeI GAWTC 1 cut(s) 251
PflMI CCANNNNNTGG 3 cut(s) 35, 110, 131
PfoI TCCNGGA 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 50
PscI ACATGT 1 cut(s) 173
Psp5II RGGWCCY 1 cut(s) 50
Psp6I CCWGG 3 cut(s) 34, 52, 109
PspGI CCWGG 3 cut(s) 34, 52, 109
PspN4I GGNNCC 1 cut(s) 115
PspPI GGNCC 2 cut(s) 14, 50
PspPPI RGGWCCY 1 cut(s) 50
PsuI RGATCY 1 cut(s) 365
Sau3AI GATC 2 cut(s) 292, 365
Sau96I GGNCC 2 cut(s) 14, 50
ScrFI CCNGG 3 cut(s) 36, 54, 111
SetI ASST 7 cut(s) 55, 100, 109, 130, 262, 301, 325
SinI GGWCC 2 cut(s) 14, 50
SmlI CTYRAG 1 cut(s) 70
SmoI CTYRAG 1 cut(s) 70
Sse9I AATT 4 cut(s) 30, 65, 168, 330
SseBI AGGCCT 1 cut(s) 61
StuI AGGCCT 1 cut(s) 61
StyD4I CCNGG 3 cut(s) 34, 52, 109
StyI CCWWGG 1 cut(s) 149
TaaI ACNGT 1 cut(s) 234
TaiI ACGT 1 cut(s) 100
TasI AATT 4 cut(s) 30, 65, 168, 330
TfiI GAWTC 1 cut(s) 251
Van91I CCANNNNNTGG 3 cut(s) 35, 110, 131
VpaK11BI GGWCC 2 cut(s) 14, 50
XapI RAATTY 2 cut(s) 65, 330
XceI RCATGY 2 cut(s) 177, 290
XmiI GTMKAC 1 cut(s) 100
Zsp2I ATGCAT 1 cut(s) 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.