Rroxscaffold_3G00231610

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000691
Physical Location & Seq
Reverse (-)
16869465 .. 16869781
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00231610.1

Sequence Viewer

Length: 222 bp
ATGATCTCATCACCACCTCTACCTCGGTCTTCTTTGCAGCCCACCGTTATCGGATCATCTCATACGTCCAGGACATTTGTATGTCCTAAGACAGGGATGCCACTCAAGACCAAGTCAATAGCACATAAGCCTAAGCCTAAACTTGTGATAGGAACAAGCACTAAAGCAAGAGCCCAACAAGGACCAAAGGAGGGTTCCAACAAGAAAATTTGGAAGCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

7.86

Weight (kDa)

11.31

Isoelectric Point (pI)

52.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 207
AfiI CCNNNNNNNGG 2 cut(s) 92, 191
AjnI CCWGG 1 cut(s) 68
AjuI GAANNNNNNNTTGG 2 cut(s) 178, 210
AlwI GGATC 1 cut(s) 61
ApeKI GCWGC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 207
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 3
AvaII GGWCC 1 cut(s) 182
BanII GRGCYC 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 21
BbvI GCAGC 1 cut(s) 49
BceAI ACGGC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 70
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 70
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmiI GGNNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 70
BmsI GCATC 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 21
Bpu10I CCTNAGC 1 cut(s) 132
BpuEI CTTGAG 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 23
Bsc4I CCNNNNNNNGG 2 cut(s) 92, 191
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 23
BseGI GGATG 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 92, 191
BseXI GCAGC 1 cut(s) 49
BslI CCNNNNNNNGG 2 cut(s) 92, 191
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 2 cut(s) 3, 53
BspLI GGNNCC 1 cut(s) 196
BspPI GGATC 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 23
BssMI GATC 2 cut(s) 3, 53
Bst2UI CCWGG 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 87, 132
BstENI CCTNNNNNAGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 102
BstKTI GATC 2 cut(s) 6, 56
BstMBI GATC 2 cut(s) 3, 53
BstNI CCWGG 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 68
BstV1I GCAGC 1 cut(s) 49
BstV2I GAAGAC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 182
CviJI RGCY 5 cut(s) 40, 130, 136, 173, 217
CviKI_1 RGCY 5 cut(s) 40, 130, 136, 173, 217
DdeI CTNAG 2 cut(s) 87, 132
DpnI GATC 2 cut(s) 5, 55
DpnII GATC 2 cut(s) 3, 53
Eco24I GRGCYC 1 cut(s) 175
Eco47I GGWCC 1 cut(s) 182
EcoNI CCTNNNNNAGG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 68
EcoT38I GRGCYC 1 cut(s) 175
FaiI YATR 3 cut(s) 63, 82, 126
Fnu4HI GCNGC 1 cut(s) 38
FokI GGATG 1 cut(s) 109
FriOI GRGCYC 1 cut(s) 175
Fsp4HI GCNGC 1 cut(s) 38
GluI GCNGC 1 cut(s) 38
HphI GGTGA 1 cut(s) 3
Hpy188I TCNGA 1 cut(s) 53
Hpy188III TCNNGA 1 cut(s) 106
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 87, 132
HpySE526I ACGT 1 cut(s) 65
Kzo9I GATC 2 cut(s) 3, 53
LpnPI CCDG 3 cut(s) 55, 78, 82
Lsp1109I GCAGC 1 cut(s) 49
LweI GCATC 1 cut(s) 87
MaeII ACGT 1 cut(s) 65
MalI GATC 2 cut(s) 5, 55
MboI GATC 2 cut(s) 3, 53
MboII GAAGA 1 cut(s) 21
MhlI GDGCHC 1 cut(s) 175
MluCI AATT 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 3 cut(s) 27, 33, 184
MslI CAYNNNNRTG 1 cut(s) 79
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
NdeII GATC 2 cut(s) 3, 53
NlaIV GGNNCC 1 cut(s) 196
PflFI GACNNNGTC 1 cut(s) 112
PfoI TCCNGGA 1 cut(s) 68
PkrI GCNGC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 196
PspPI GGNCC 1 cut(s) 182
PsyI GACNNNGTC 1 cut(s) 112
RseI CAYNNNNRTG 1 cut(s) 79
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 2 cut(s) 3, 53
Sau96I GGNCC 1 cut(s) 182
ScrFI CCNGG 1 cut(s) 70
SduI GDGCHC 1 cut(s) 175
SetI ASST 3 cut(s) 19, 25, 68
SfaNI GCATC 1 cut(s) 87
SinI GGWCC 1 cut(s) 182
SmiMI CAYNNNNRTG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 68
TaaI ACNGT 1 cut(s) 46
TaiI ACGT 1 cut(s) 68
TaqII GACCGA 1 cut(s) 15
TasI AATT 1 cut(s) 207
TseI GCWGC 1 cut(s) 37
Tth111I GACNNNGTC 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 182
XagI CCTNNNNNAGG 1 cut(s) 90
XapI RAATTY 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.