Rh3CG278400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
27949095 .. 27949974
880 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG278400.1

Sequence Viewer

Length: 399 bp
ATGCAACAAGGCGATGCAAATGAAAAAGGTTCTCAAAATGTTCAGCAAGATGGCAATGCAAATGATGAACATAGAATGCAGAATGCTCAGCAATGTGGCAATTCTAATGGACATAGTTCTCAAAATGTTCGTGATGAGGAGCATCATGAGATTCCATCTCAACAATCACTTGCGAAAGCACCTTTTATTTCATCGCAACCACTTCCATCACCTCTAAATTTCTCACAAGAAATTCCTCCAGTTCAAAGAAGTTCTCAACCTATTGGATCATTCTTAGCTTCCTTCTCTATGATGTACACTGATCCTGTAACAAGGAGGCCAAAGAAGCAAGTTGCATTCAGAAATCCGAAGAATTCTATGTCAACTGAGAATGCAAGCAAGCCTATTTGGAGACCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

14.73

Weight (kDa)

7.95

Isoelectric Point (pI)

67.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 274, 296
AcsI RAATTY 3 cut(s) 217, 231, 352
AfaI GTAC 1 cut(s) 296
AgsI TTSAA 1 cut(s) 245
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
Alw26I GTCTC 1 cut(s) 385
AlwI GGATC 2 cut(s) 274, 296
AoxI GGCC 1 cut(s) 317
ApoI RAATTY 3 cut(s) 217, 231, 352
AsuHPI GGTGA 1 cut(s) 201
BccI CCATC 3 cut(s) 44, 163, 214
BcoDI GTCTC 1 cut(s) 385
BlpI GCTNAGC 1 cut(s) 87
BmsI GCATC 2 cut(s) 4, 151
BpmI CTGGAG 1 cut(s) 222
Bpu1102I GCTNAGC 1 cut(s) 87
BsaI GGTCTC 1 cut(s) 385
Bse1I ACTGG 1 cut(s) 239
Bse3DI GCAATG 2 cut(s) 61, 98
BseMI GCAATG 2 cut(s) 61, 98
BseMII CTCAG 2 cut(s) 101, 357
BseNI ACTGG 1 cut(s) 239
BseRI GAGGAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 319
BsmAI GTCTC 1 cut(s) 385
BsmI GAATGC 4 cut(s) 81, 88, 335, 376
BsnI GGCC 1 cut(s) 319
Bso31I GGTCTC 1 cut(s) 385
Bsp1407I TGTACA 1 cut(s) 294
Bsp143I GATC 2 cut(s) 266, 301
Bsp1720I GCTNAGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 319
BspCNI CTCAG 2 cut(s) 100, 358
BspHI TCATGA 1 cut(s) 145
BspPI GGATC 2 cut(s) 274, 296
BspTNI GGTCTC 1 cut(s) 385
BsrDI GCAATG 2 cut(s) 61, 98
BsrGI TGTACA 1 cut(s) 294
BsrI ACTGG 1 cut(s) 239
BssMI GATC 2 cut(s) 266, 301
BstAUI TGTACA 1 cut(s) 294
BstC8I GCNNGC 2 cut(s) 376, 380
BstDEI CTNAG 3 cut(s) 87, 274, 366
BstKTI GATC 2 cut(s) 269, 304
BstMAI GTCTC 1 cut(s) 385
BstMBI GATC 2 cut(s) 266, 301
BstMWI GCNNNNNNNGC 1 cut(s) 325
BsuRI GGCC 1 cut(s) 319
BtgZI GCGATG 2 cut(s) 27, 177
BtsIMutI CAGTG 1 cut(s) 297
Cac8I GCNNGC 2 cut(s) 376, 380
CciI TCATGA 1 cut(s) 145
Csp6I GTAC 1 cut(s) 295
CviAII CATG 1 cut(s) 146
CviJI RGCY 3 cut(s) 278, 319, 382
CviKI_1 RGCY 3 cut(s) 278, 319, 382
CviQI GTAC 1 cut(s) 295
DdeI CTNAG 3 cut(s) 87, 274, 366
DpnI GATC 2 cut(s) 268, 303
DpnII GATC 2 cut(s) 266, 301
Eco31I GGTCTC 1 cut(s) 385
EcoRI GAATTC 1 cut(s) 352
FaeI CATG 1 cut(s) 149
FaiI YATR 5 cut(s) 72, 114, 147, 290, 359
FatI CATG 1 cut(s) 145
GsuI CTGGAG 1 cut(s) 222
HaeIII GGCC 1 cut(s) 319
Hin1II CATG 1 cut(s) 149
HincII GTYRAC 1 cut(s) 363
HindII GTYRAC 1 cut(s) 363
HinfI GANTC 1 cut(s) 151
HphI GGTGA 1 cut(s) 201
Hpy166II GTNNAC 2 cut(s) 297, 363
Hpy188I TCNGA 2 cut(s) 341, 348
Hpy188III TCNNGA 2 cut(s) 131, 146
Hpy8I GTNNAC 2 cut(s) 297, 363
HpyAV CCTTC 1 cut(s) 292
HpyCH4V TGCA 6 cut(s) 4, 17, 59, 79, 335, 374
HpyF10VI GCNNNNNNNGC 1 cut(s) 325
HpyF3I CTNAG 3 cut(s) 87, 274, 366
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 2 cut(s) 266, 301
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 2 cut(s) 252, 318
LweI GCATC 2 cut(s) 4, 151
MaeIII GTNAC 1 cut(s) 307
MalI GATC 2 cut(s) 268, 303
MboI GATC 2 cut(s) 266, 301
MboII GAAGA 1 cut(s) 361
MluCI AATT 4 cut(s) 100, 217, 231, 352
MnlI CCTC 4 cut(s) 130, 222, 246, 309
MseI TTAA 1 cut(s) 397
Mva1269I GAATGC 4 cut(s) 81, 88, 335, 376
MwoI GCNNNNNNNGC 1 cut(s) 325
NdeII GATC 2 cut(s) 266, 301
NlaIII CATG 1 cut(s) 149
PagI TCATGA 1 cut(s) 145
PctI GAATGC 4 cut(s) 81, 88, 335, 376
PfeI GAWTC 1 cut(s) 151
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SaqAI TTAA 1 cut(s) 397
Sau3AI GATC 2 cut(s) 266, 301
SetI ASST 6 cut(s) 31, 184, 214, 262, 280, 397
SfaNI GCATC 2 cut(s) 4, 151
Sse9I AATT 4 cut(s) 100, 217, 231, 352
TasI AATT 4 cut(s) 100, 217, 231, 352
TatI WGTACW 1 cut(s) 294
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 1 cut(s) 397
Tru9I TTAA 1 cut(s) 397
TscAI CASTG 1 cut(s) 304
TspDTI ATGAA 3 cut(s) 36, 81, 180
TspRI CASTG 1 cut(s) 304
XapI RAATTY 3 cut(s) 217, 231, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.