Rh5CG402400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000691
Physical Location & Seq
Reverse (-)
53558097 .. 53558375
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG402400.1

Sequence Viewer

Length: 179 bp
ATGGCCATAATAAGAGGACTTGTTCAAGGAGACAGCAACAAGGCAATGATTTCCAAGCTGGGGTTCAACCATCAGAAACTGATGATCAGAGTGTCCATGTGGAGCAAGCTGAAAATGTTCAAAGTGATGTGCAAGTTGAAAGTGATATGCATTCTGGATCAATGCAGCAAACTGCAAAT
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.79

Weight (kDa)

10.13

Isoelectric Point (pI)

15.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 165
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 60
AgsI TTSAA 4 cut(s) 26, 67, 121, 139
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 2 cut(s) 58, 109
AluI AGCT 2 cut(s) 58, 109
Alw26I GTCTC 1 cut(s) 24
AlwI GGATC 1 cut(s) 165
AlwNI CAGNNNCTG 1 cut(s) 79
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 165
Asp700I GAANNNNTTC 1 cut(s) 116
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 78
BclI TGATCA 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 24
BisI GCNGC 1 cut(s) 166
BlsI GCNGC 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 60
Bse3DI GCAATG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 60
BseMI GCAATG 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 58
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 60
BsmAI GTCTC 1 cut(s) 24
BsmI GAATGC 1 cut(s) 150
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 84, 157
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 51
BssMI GATC 2 cut(s) 84, 157
BstC8I GCNNGC 1 cut(s) 107
BstKTI GATC 2 cut(s) 87, 160
BstMAI GTCTC 1 cut(s) 24
BstMBI GATC 2 cut(s) 84, 157
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 107
CaiI CAGNNNCTG 1 cut(s) 79
CviAII CATG 1 cut(s) 97
CviJI RGCY 3 cut(s) 5, 58, 109
CviKI_1 RGCY 3 cut(s) 5, 58, 109
DpnI GATC 2 cut(s) 86, 159
DpnII GATC 2 cut(s) 84, 157
EaeI YGGCCR 1 cut(s) 3
EcoT22I ATGCAT 1 cut(s) 152
FaeI CATG 1 cut(s) 100
FaiI YATR 3 cut(s) 8, 98, 148
FatI CATG 1 cut(s) 96
FbaI TGATCA 1 cut(s) 84
Fnu4HI GCNGC 1 cut(s) 166
Fsp4HI GCNGC 1 cut(s) 166
GluI GCNGC 1 cut(s) 166
GsaI CCCAGC 1 cut(s) 62
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 75, 89
Hpy188III TCNNGA 1 cut(s) 155
HpyCH4V TGCA 4 cut(s) 132, 150, 165, 175
Hsp92II CATG 1 cut(s) 100
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 2 cut(s) 84, 157
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 2 cut(s) 44, 140
MalI GATC 2 cut(s) 86, 159
MboI GATC 2 cut(s) 84, 157
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 8
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 152
MroXI GAANNNNTTC 1 cut(s) 116
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
Mva1269I GAATGC 1 cut(s) 150
NdeII GATC 2 cut(s) 84, 157
NlaIII CATG 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 152
PctI GAATGC 1 cut(s) 150
PdmI GAANNNNTTC 1 cut(s) 116
PkrI GCNGC 1 cut(s) 167
PspFI CCCAGC 1 cut(s) 58
PstNI CAGNNNCTG 1 cut(s) 79
SatI GCNGC 1 cut(s) 166
Sau3AI GATC 2 cut(s) 84, 157
SetI ASST 2 cut(s) 60, 111
SgeI CNNG 9 cut(s) 32, 38, 52, 67, 71, 109, 118, 145, 167
TseI GCWGC 1 cut(s) 165
XmnI GAANNNNTTC 1 cut(s) 116
Zsp2I ATGCAT 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.