Rmu_sc0010616.1_g000005

SAM dependent carboxyl methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010616.1
OG0000691
Physical Location & Seq
Reverse (-)
16714 .. 17444
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010616.1_g000005.1.cds

Sequence Viewer

Length: 501 bp
atgtcctctgatgactttgtagatgcatgctataccacgaagacatgtatgaaggcttatgatccaattatgcatccaattgctggagtaaaagagtgggaaaagattcataggccaattgcaccttctttggatagaagacaacctggcaggtctaaaatgaataggaccaaagaaccagatgaggtggctccacctcttggaacaaccaagttaccaaaagtctactactctcaggtaaaatgtgggattttacatcaaaaaggccacaataagaggacatgcctcaagagaaatcagatgcccagcctcagcctatgcatatgcctccccagcctgagcctatgcctttccagcccgctgaccctgtgcaaccctaatctcagagtgaccaggggccccaagtggattatgtggctacccaacagtcctagactacatcatctgcccaagcaggagggtcctagccccagttcagagttaggaggttcaaagccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00592 ko01110 map00592 map01110
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

166

Amino Acids

18.62

Weight (kDa)

9.61

Isoelectric Point (pI)

72.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 141
AccB7I CCANNNNNTGG 2 cut(s) 83, 200
AccI GTMKAC 1 cut(s) 225
AciI CCGC 1 cut(s) 359
AclWI GGATC 1 cut(s) 56
AfiI CCNNNNNNNGG 2 cut(s) 83, 200
AflIII ACRYGT 1 cut(s) 44
AgsI TTSAA 1 cut(s) 492
AjnI CCWGG 2 cut(s) 145, 392
AjuI GAANNNNNNNTTGG 2 cut(s) 109, 141
AlwI GGATC 1 cut(s) 56
AoxI GGCC 3 cut(s) 113, 265, 397
ApaI GGGCCC 1 cut(s) 401
Asp700I GAANNNNTTC 1 cut(s) 105
AspS9I GGNCC 4 cut(s) 168, 397, 398, 461
AvaII GGWCC 2 cut(s) 168, 461
BaeGI GKGCMC 1 cut(s) 401
BanII GRGCYC 1 cut(s) 401
BbsI GAAGAC 2 cut(s) 47, 145
BbvCI CCTCAGC 1 cut(s) 311
BciT130I CCWGG 2 cut(s) 147, 394
BfaI CTAG 3 cut(s) 432, 465, 499
BfuAI ACCTGC 1 cut(s) 141
Bme1390I CCNGG 2 cut(s) 147, 394
Bme18I GGWCC 2 cut(s) 168, 461
BmgT120I GGNCC 4 cut(s) 168, 397, 398, 461
BmiI GGNNCC 5 cut(s) 192, 398, 399, 400, 462
BmrFI CCNGG 2 cut(s) 147, 394
BmrI ACTGGG 1 cut(s) 465
BmsI GCATC 3 cut(s) 13, 82, 291
BmuI ACTGGG 1 cut(s) 465
BpiI GAAGAC 2 cut(s) 47, 145
BpmI CTGGAG 1 cut(s) 105
Bpu10I CCTNAGC 2 cut(s) 311, 338
BpuEI CTTGAG 1 cut(s) 272
BsaJI CCNNGG 1 cut(s) 393
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 200
Bse1I ACTGG 1 cut(s) 471
BseBI CCWGG 2 cut(s) 147, 394
BseDI CCNNGG 1 cut(s) 393
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 2 cut(s) 83, 200
BseMII CTCAG 4 cut(s) 248, 325, 329, 397
BseNI ACTGG 1 cut(s) 471
BseSI GKGCMC 1 cut(s) 401
BseYI CCCAGC 2 cut(s) 305, 332
BshFI GGCC 3 cut(s) 115, 267, 399
BslI CCNNNNNNNGG 2 cut(s) 83, 200
BsnI GGCC 3 cut(s) 115, 267, 399
Bsp120I GGGCCC 1 cut(s) 397
Bsp1286I GDGCHC 1 cut(s) 401
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 359
BspANI GGCC 3 cut(s) 115, 267, 399
BspCNI CTCAG 4 cut(s) 247, 324, 330, 396
BspLI GGNNCC 5 cut(s) 192, 398, 399, 400, 462
BspMI ACCTGC 1 cut(s) 141
BspPI GGATC 1 cut(s) 56
BsrI ACTGG 1 cut(s) 471
BssECI CCNNGG 1 cut(s) 393
BssMI GATC 1 cut(s) 61
Bst2UI CCWGG 2 cut(s) 147, 394
Bst4CI ACNGT 1 cut(s) 428
BstC8I GCNNGC 2 cut(s) 28, 359
BstDEI CTNAG 4 cut(s) 234, 311, 338, 383
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 2 cut(s) 333, 354
BstNI CCWGG 2 cut(s) 147, 394
BstNSI RCATGY 3 cut(s) 30, 48, 285
BstSCI CCNGG 2 cut(s) 145, 392
BstSLI GKGCMC 1 cut(s) 401
BstV2I GAAGAC 2 cut(s) 47, 145
BsuRI GGCC 3 cut(s) 115, 267, 399
BtsCI GGATG 1 cut(s) 73
BveI ACCTGC 1 cut(s) 141
Cac8I GCNNGC 2 cut(s) 28, 359
Cfr13I GGNCC 4 cut(s) 168, 397, 398, 461
CviAII CATG 3 cut(s) 27, 45, 282
DdeI CTNAG 4 cut(s) 234, 311, 338, 383
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco24I GRGCYC 1 cut(s) 401
Eco47I GGWCC 2 cut(s) 168, 461
EcoO109I RGGNCCY 3 cut(s) 397, 398, 461
EcoRII CCWGG 2 cut(s) 145, 392
EcoT22I ATGCAT 3 cut(s) 28, 75, 323
EcoT38I GRGCYC 1 cut(s) 401
FaeI CATG 3 cut(s) 30, 48, 285
FatI CATG 3 cut(s) 26, 44, 281
FauI CCCGC 1 cut(s) 366
FauNDI CATATG 1 cut(s) 323
FblI GTMKAC 1 cut(s) 225
FokI GGATG 1 cut(s) 60
FriOI GRGCYC 1 cut(s) 401
FspBI CTAG 3 cut(s) 432, 465, 499
GsaI CCCAGC 2 cut(s) 309, 336
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 3 cut(s) 115, 267, 399
Hin1II CATG 3 cut(s) 30, 48, 285
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 226
Hpy188I TCNGA 4 cut(s) 10, 300, 386, 478
Hpy188III TCNNGA 1 cut(s) 289
Hpy8I GTNNAC 1 cut(s) 226
HpyAV CCTTC 2 cut(s) 46, 135
HpyCH4III ACNGT 1 cut(s) 428
HpyCH4V TGCA 5 cut(s) 26, 73, 122, 321, 372
HpyF10VI GCNNNNNNNGC 2 cut(s) 333, 354
HpyF3I CTNAG 4 cut(s) 234, 311, 338, 383
Hsp92II CATG 3 cut(s) 30, 48, 285
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 196
LweI GCATC 3 cut(s) 13, 82, 291
MaeI CTAG 3 cut(s) 432, 465, 499
MaeIII GTNAC 2 cut(s) 213, 388
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 2 cut(s) 52, 150
MfeI CAATTG 2 cut(s) 78, 117
MhlI GDGCHC 1 cut(s) 401
MluCI AATT 3 cut(s) 66, 78, 117
MnlI CCTC 9 cut(s) 16, 178, 207, 270, 296, 320, 338, 451, 479
Mph1103I ATGCAT 3 cut(s) 28, 75, 323
MroXI GAANNNNTTC 1 cut(s) 105
MspA1I CMGCKG 1 cut(s) 361
MspR9I CCNGG 2 cut(s) 147, 394
MunI CAATTG 2 cut(s) 78, 117
MvaI CCWGG 2 cut(s) 147, 394
MwoI GCNNNNNNNGC 2 cut(s) 333, 354
NdeI CATATG 1 cut(s) 323
NdeII GATC 1 cut(s) 61
NlaIII CATG 3 cut(s) 30, 48, 285
NlaIV GGNNCC 5 cut(s) 192, 398, 399, 400, 462
NmuCI GTSAC 1 cut(s) 388
NsiI ATGCAT 3 cut(s) 28, 75, 323
NspI RCATGY 3 cut(s) 30, 48, 285
PaeI GCATGC 1 cut(s) 30
PciI ACATGT 1 cut(s) 44
PdmI GAANNNNTTC 1 cut(s) 105
PfeI GAWTC 1 cut(s) 106
PflMI CCANNNNNTGG 2 cut(s) 83, 200
PpuMI RGGWCCY 1 cut(s) 461
PscI ACATGT 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 461
Psp6I CCWGG 2 cut(s) 145, 392
PspFI CCCAGC 2 cut(s) 305, 332
PspGI CCWGG 2 cut(s) 145, 392
PspN4I GGNNCC 5 cut(s) 192, 398, 399, 400, 462
PspOMI GGGCCC 1 cut(s) 397
PspPI GGNCC 4 cut(s) 168, 397, 398, 461
PspPPI RGGWCCY 1 cut(s) 461
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 4 cut(s) 168, 397, 398, 461
ScrFI CCNGG 2 cut(s) 147, 394
SduI GDGCHC 1 cut(s) 401
SetI ASST 7 cut(s) 127, 148, 155, 189, 199, 240, 490
SfaNI GCATC 3 cut(s) 13, 82, 291
SinI GGWCC 2 cut(s) 168, 461
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
SphI GCATGC 1 cut(s) 30
Sse9I AATT 3 cut(s) 66, 78, 117
SsiI CCGC 1 cut(s) 359
SspMI CTAG 3 cut(s) 432, 465, 499
StyD4I CCNGG 2 cut(s) 145, 392
TaaI ACNGT 1 cut(s) 428
TasI AATT 3 cut(s) 66, 78, 117
TfiI GAWTC 1 cut(s) 106
TseFI GTSAC 1 cut(s) 388
Tsp45I GTSAC 1 cut(s) 388
TspDTI ATGAA 3 cut(s) 65, 98, 176
Van91I CCANNNNNTGG 2 cut(s) 83, 200
VpaK11BI GGWCC 2 cut(s) 168, 461
XceI RCATGY 3 cut(s) 30, 48, 285
XmiI GTMKAC 1 cut(s) 225
XmnI GAANNNNTTC 1 cut(s) 105
XspI CTAG 3 cut(s) 432, 465, 499
Zsp2I ATGCAT 3 cut(s) 28, 75, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.