Rroxscaffold_2G00087850

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000691
Physical Location & Seq
Reverse (-)
9926517 .. 9926986
470 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00087850.1

Sequence Viewer

Length: 297 bp
ATGCATTATGGATCGGTGCAGCAAACTGCAAATGTACCAACACCCTCAATTGTTGCAAGTGCTTCATCTCAACCGATGATCTCATCACCACCTCTACCTCGGTCTTCTTTGCAGCCCTTTGTTATCGGATCATCTCATACGTCCAGGACATTTGTATGTCCTAAGACAAGGATGCCACTCAAGACCAAGTCAATAGCACATAAGCCTAAGCCTAAACTTGTGATAGGAACAAGCACTAAAGCAAGAGCCCAACAAGGACCAAAGGAGGGTTCCAACAAGAAAATTTGGAAGCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.55

Weight (kDa)

11.27

Isoelectric Point (pI)

63.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 19, 136
AcsI RAATTY 1 cut(s) 282
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 1 cut(s) 266
AjnI CCWGG 1 cut(s) 143
AjuI GAANNNNNNNTTGG 2 cut(s) 253, 285
AlwI GGATC 2 cut(s) 19, 136
ApeKI GCWGC 2 cut(s) 19, 112
ApoI RAATTY 1 cut(s) 282
AspS9I GGNCC 1 cut(s) 257
AsuHPI GGTGA 1 cut(s) 78
AvaII GGWCC 1 cut(s) 257
BanII GRGCYC 1 cut(s) 250
BbsI GAAGAC 1 cut(s) 96
BbvI GCAGC 2 cut(s) 31, 124
BceAI ACGGC 1 cut(s) 277
BciT130I CCWGG 1 cut(s) 145
BisI GCNGC 2 cut(s) 20, 113
BlsI GCNGC 2 cut(s) 21, 114
Bme1390I CCNGG 1 cut(s) 145
Bme18I GGWCC 1 cut(s) 257
BmgT120I GGNCC 1 cut(s) 257
BmiI GGNNCC 1 cut(s) 271
BmrFI CCNGG 1 cut(s) 145
BmsI GCATC 1 cut(s) 162
BpiI GAAGAC 1 cut(s) 96
Bpu10I CCTNAGC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 266
BseBI CCWGG 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 98
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 266
BseXI GCAGC 2 cut(s) 31, 124
BsgI GTGCAG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 266
Bsp1286I GDGCHC 1 cut(s) 250
Bsp143I GATC 3 cut(s) 11, 78, 128
BspLI GGNNCC 1 cut(s) 271
BspPI GGATC 2 cut(s) 19, 136
BssECI CCNNGG 1 cut(s) 98
BssMI GATC 3 cut(s) 11, 78, 128
Bst2UI CCWGG 1 cut(s) 145
BstDEI CTNAG 2 cut(s) 162, 207
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 3 cut(s) 14, 81, 131
BstMBI GATC 3 cut(s) 11, 78, 128
BstNI CCWGG 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 143
BstV1I GCAGC 2 cut(s) 31, 124
BstV2I GAAGAC 1 cut(s) 96
BtsCI GGATG 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 257
Csp6I GTAC 1 cut(s) 35
CviJI RGCY 5 cut(s) 115, 205, 211, 248, 292
CviKI_1 RGCY 5 cut(s) 115, 205, 211, 248, 292
CviQI GTAC 1 cut(s) 35
DdeI CTNAG 2 cut(s) 162, 207
DpnI GATC 3 cut(s) 13, 80, 130
DpnII GATC 3 cut(s) 11, 78, 128
Eco24I GRGCYC 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 257
EcoRII CCWGG 1 cut(s) 143
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 250
FaiI YATR 4 cut(s) 9, 138, 157, 201
Fnu4HI GCNGC 2 cut(s) 20, 113
FokI GGATG 1 cut(s) 184
FriOI GRGCYC 1 cut(s) 250
Fsp4HI GCNGC 2 cut(s) 20, 113
GluI GCNGC 2 cut(s) 20, 113
HphI GGTGA 1 cut(s) 78
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 140
HpyCH4V TGCA 5 cut(s) 4, 19, 29, 56, 112
HpyF3I CTNAG 2 cut(s) 162, 207
HpySE526I ACGT 1 cut(s) 140
Kzo9I GATC 3 cut(s) 11, 78, 128
LpnPI CCDG 2 cut(s) 130, 157
Lsp1109I GCAGC 2 cut(s) 31, 124
LweI GCATC 1 cut(s) 162
MaeII ACGT 1 cut(s) 140
MalI GATC 3 cut(s) 13, 80, 130
MboI GATC 3 cut(s) 11, 78, 128
MboII GAAGA 1 cut(s) 96
MfeI CAATTG 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 250
MluCI AATT 2 cut(s) 48, 282
MmeI TCCRAC 1 cut(s) 297
MnlI CCTC 4 cut(s) 55, 102, 108, 259
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 145
MunI CAATTG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 145
NdeII GATC 3 cut(s) 11, 78, 128
NlaIV GGNNCC 1 cut(s) 271
NsiI ATGCAT 1 cut(s) 6
PflFI GACNNNGTC 1 cut(s) 187
PfoI TCCNGGA 1 cut(s) 143
PkrI GCNGC 2 cut(s) 21, 114
Psp6I CCWGG 1 cut(s) 143
PspGI CCWGG 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 271
PspPI GGNCC 1 cut(s) 257
PsyI GACNNNGTC 1 cut(s) 187
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
RseI CAYNNNNRTG 1 cut(s) 154
SatI GCNGC 2 cut(s) 20, 113
Sau3AI GATC 3 cut(s) 11, 78, 128
Sau96I GGNCC 1 cut(s) 257
ScrFI CCNGG 1 cut(s) 145
SduI GDGCHC 1 cut(s) 250
SetI ASST 3 cut(s) 94, 100, 143
SfaNI GCATC 1 cut(s) 162
SinI GGWCC 1 cut(s) 257
SmiMI CAYNNNNRTG 1 cut(s) 154
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 2 cut(s) 48, 282
StyD4I CCNGG 1 cut(s) 143
TaiI ACGT 1 cut(s) 143
TaqII GACCGA 1 cut(s) 90
TasI AATT 2 cut(s) 48, 282
TseI GCWGC 2 cut(s) 19, 112
TspDTI ATGAA 1 cut(s) 54
Tth111I GACNNNGTC 1 cut(s) 187
VpaK11BI GGWCC 1 cut(s) 257
XapI RAATTY 1 cut(s) 282
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.