RchiOBHm_Chr7g0212591

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
29831755 .. 29834273
2519 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19024

Sequence Viewer

Length: 300 bp
ATGGAGAGCCACCCACCTACAAAGGAGCATCATGAGATTCCATCTCAACAATCACTTGCGAAAGCACCTTTTGTTTCATCGCAACCACTTCCATCACCTCTAAATTTCTCACAAGAAATTCCTCCAGTTCAAAGAAGTTCTCAACCTATTGGATCATTCTTAGCTTCCTTCTCCTCCATCATGAACACTGATCCTGTAACAGGGAGGCCAAAGAAGCAAGTTGCATTCAGAAATCCTAAGAATTCTATGTCAACTGAGAATGCAAGCAAGCCTATAGGGCATTTTGTGATAACTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

10.83

Weight (kDa)

9.7

Isoelectric Point (pI)

71.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 160, 185
AcsI RAATTY 3 cut(s) 103, 117, 241
AfiI CCNNNNNNNGG 1 cut(s) 200
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AlwI GGATC 2 cut(s) 160, 185
AoxI GGCC 1 cut(s) 206
ApoI RAATTY 3 cut(s) 103, 117, 241
AsuHPI GGTGA 1 cut(s) 87
BccI CCATC 3 cut(s) 49, 100, 185
BfmI CTRYAG 1 cut(s) 273
BglI GCCNNNNNGGC 1 cut(s) 277
BmsI GCATC 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 200
BseMII CTCAG 1 cut(s) 246
BseNI ACTGG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 163
BshFI GGCC 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 200
BsmI GAATGC 2 cut(s) 224, 265
BsnI GGCC 1 cut(s) 208
Bsp143I GATC 2 cut(s) 152, 190
BspANI GGCC 1 cut(s) 208
BspCNI CTCAG 1 cut(s) 247
BspHI TCATGA 2 cut(s) 31, 180
BspPI GGATC 2 cut(s) 160, 185
BsrI ACTGG 1 cut(s) 125
BssMI GATC 2 cut(s) 152, 190
BstC8I GCNNGC 2 cut(s) 265, 269
BstDEI CTNAG 3 cut(s) 160, 237, 255
BstENI CCTNNNNNAGG 1 cut(s) 198
BstKTI GATC 2 cut(s) 155, 193
BstMBI GATC 2 cut(s) 152, 190
BstMWI GCNNNNNNNGC 2 cut(s) 214, 277
BstSFI CTRYAG 1 cut(s) 273
BsuRI GGCC 1 cut(s) 208
BtgZI GCGATG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 2 cut(s) 265, 269
CciI TCATGA 2 cut(s) 31, 180
CviAII CATG 2 cut(s) 32, 181
CviJI RGCY 4 cut(s) 9, 164, 208, 271
CviKI_1 RGCY 4 cut(s) 9, 164, 208, 271
DdeI CTNAG 3 cut(s) 160, 237, 255
DpnI GATC 2 cut(s) 154, 192
DpnII GATC 2 cut(s) 152, 190
EcoNI CCTNNNNNAGG 1 cut(s) 198
EcoRI GAATTC 1 cut(s) 241
FaeI CATG 2 cut(s) 35, 184
FaiI YATR 4 cut(s) 33, 182, 248, 275
FatI CATG 2 cut(s) 31, 180
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 1 cut(s) 208
Hin1II CATG 2 cut(s) 35, 184
HincII GTYRAC 1 cut(s) 252
HindII GTYRAC 1 cut(s) 252
HinfI GANTC 1 cut(s) 37
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 252
Hpy188I TCNGA 1 cut(s) 230
Hpy188III TCNNGA 2 cut(s) 32, 181
Hpy8I GTNNAC 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 224, 263
HpyF10VI GCNNNNNNNGC 2 cut(s) 214, 277
HpyF3I CTNAG 3 cut(s) 160, 237, 255
Hsp92II CATG 2 cut(s) 35, 184
Kzo9I GATC 2 cut(s) 152, 190
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 138, 186, 207
LweI GCATC 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 196
MalI GATC 2 cut(s) 154, 192
MboI GATC 2 cut(s) 152, 190
MluCI AATT 3 cut(s) 103, 117, 241
MnlI CCTC 4 cut(s) 108, 132, 184, 198
Mva1269I GAATGC 2 cut(s) 224, 265
MwoI GCNNNNNNNGC 2 cut(s) 214, 277
NdeII GATC 2 cut(s) 152, 190
NlaIII CATG 2 cut(s) 35, 184
PagI TCATGA 2 cut(s) 31, 180
PctI GAATGC 2 cut(s) 224, 265
PfeI GAWTC 1 cut(s) 37
Sau3AI GATC 2 cut(s) 152, 190
SetI ASST 5 cut(s) 19, 70, 100, 148, 166
SfaNI GCATC 1 cut(s) 37
SfcI CTRYAG 1 cut(s) 273
Sse9I AATT 3 cut(s) 103, 117, 241
TasI AATT 3 cut(s) 103, 117, 241
TfiI GAWTC 1 cut(s) 37
TscAI CASTG 1 cut(s) 193
TspDTI ATGAA 2 cut(s) 66, 197
TspRI CASTG 1 cut(s) 193
XagI CCTNNNNNAGG 1 cut(s) 198
XapI RAATTY 3 cut(s) 103, 117, 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.