Rh1AG177300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
33818823 .. 33820942
2120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG177300.1

Sequence Viewer

Length: 285 bp
ATGGAGAGCCACCCACCTACAAAGGAGCATCATGAGATTCCATCTCAACAATCACTTGCGAAAGCACCTTTTATTTCATCGCAACCACTTCCATCACCTCTAAATTTCTCACAAGAAATTCCTCCAGTTCAAAGAAGTTCTCAACCTATTGGATCATTCTTAGCTTCCTTCTCTATGATGTACACTGATCCTGTAACAAGGAGGCCAAAGAAGCAAGTTGCATTCAGAAATCCTAAGAATTCTATGTCAACTGAGAATGCAAGCAAGCCTATTTGGAGACCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.6

Weight (kDa)

10.11

Isoelectric Point (pI)

84.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 160, 182
AcsI RAATTY 3 cut(s) 103, 117, 238
AfaI GTAC 1 cut(s) 182
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
Alw26I GTCTC 1 cut(s) 271
AlwI GGATC 2 cut(s) 160, 182
AoxI GGCC 1 cut(s) 203
ApoI RAATTY 3 cut(s) 103, 117, 238
AsuHPI GGTGA 1 cut(s) 87
BccI CCATC 2 cut(s) 49, 100
BcoDI GTCTC 1 cut(s) 271
BmsI GCATC 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 108
BsaI GGTCTC 1 cut(s) 271
Bse1I ACTGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 243
BseNI ACTGG 1 cut(s) 125
BshFI GGCC 1 cut(s) 205
BsmAI GTCTC 1 cut(s) 271
BsmI GAATGC 2 cut(s) 221, 262
BsnI GGCC 1 cut(s) 205
Bso31I GGTCTC 1 cut(s) 271
Bsp1407I TGTACA 1 cut(s) 180
Bsp143I GATC 2 cut(s) 152, 187
BspANI GGCC 1 cut(s) 205
BspCNI CTCAG 1 cut(s) 244
BspHI TCATGA 1 cut(s) 31
BspPI GGATC 2 cut(s) 160, 182
BspTNI GGTCTC 1 cut(s) 271
BsrGI TGTACA 1 cut(s) 180
BsrI ACTGG 1 cut(s) 125
BssMI GATC 2 cut(s) 152, 187
BstAUI TGTACA 1 cut(s) 180
BstC8I GCNNGC 2 cut(s) 262, 266
BstDEI CTNAG 3 cut(s) 160, 234, 252
BstKTI GATC 2 cut(s) 155, 190
BstMAI GTCTC 1 cut(s) 271
BstMBI GATC 2 cut(s) 152, 187
BstMWI GCNNNNNNNGC 1 cut(s) 211
BsuRI GGCC 1 cut(s) 205
BtgZI GCGATG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 183
Cac8I GCNNGC 2 cut(s) 262, 266
CciI TCATGA 1 cut(s) 31
Csp6I GTAC 1 cut(s) 181
CviAII CATG 1 cut(s) 32
CviJI RGCY 4 cut(s) 9, 164, 205, 268
CviKI_1 RGCY 4 cut(s) 9, 164, 205, 268
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 3 cut(s) 160, 234, 252
DpnI GATC 2 cut(s) 154, 189
DpnII GATC 2 cut(s) 152, 187
Eco31I GGTCTC 1 cut(s) 271
EcoRI GAATTC 1 cut(s) 238
FaeI CATG 1 cut(s) 35
FaiI YATR 3 cut(s) 33, 176, 245
FatI CATG 1 cut(s) 31
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 1 cut(s) 205
Hin1II CATG 1 cut(s) 35
HincII GTYRAC 1 cut(s) 249
HindII GTYRAC 1 cut(s) 249
HinfI GANTC 1 cut(s) 37
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 2 cut(s) 183, 249
Hpy188I TCNGA 1 cut(s) 227
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 2 cut(s) 183, 249
HpyAV CCTTC 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 221, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpyF3I CTNAG 3 cut(s) 160, 234, 252
Hsp92II CATG 1 cut(s) 35
Kzo9I GATC 2 cut(s) 152, 187
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 138, 204
LweI GCATC 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 193
MalI GATC 2 cut(s) 154, 189
MboI GATC 2 cut(s) 152, 187
MluCI AATT 3 cut(s) 103, 117, 238
MnlI CCTC 3 cut(s) 108, 132, 195
MseI TTAA 1 cut(s) 283
Mva1269I GAATGC 2 cut(s) 221, 262
MwoI GCNNNNNNNGC 1 cut(s) 211
NdeII GATC 2 cut(s) 152, 187
NlaIII CATG 1 cut(s) 35
PagI TCATGA 1 cut(s) 31
PctI GAATGC 2 cut(s) 221, 262
PfeI GAWTC 1 cut(s) 37
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SaqAI TTAA 1 cut(s) 283
Sau3AI GATC 2 cut(s) 152, 187
SetI ASST 6 cut(s) 19, 70, 100, 148, 166, 283
SfaNI GCATC 1 cut(s) 37
SgeI CNNG 9 cut(s) 44, 68, 125, 137, 203, 210, 227, 273, 277
Sse9I AATT 3 cut(s) 103, 117, 238
TasI AATT 3 cut(s) 103, 117, 238
TatI WGTACW 1 cut(s) 180
TfiI GAWTC 1 cut(s) 37
Tru1I TTAA 1 cut(s) 283
Tru9I TTAA 1 cut(s) 283
TscAI CASTG 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 66
TspRI CASTG 1 cut(s) 190
XapI RAATTY 3 cut(s) 103, 117, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.