Rw7G008390

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
7640863 .. 7641869
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G008390.1

Sequence Viewer

Length: 441 bp
ATGCTTGCATATGGTCCAGCCATAAACCCAATTCCTGGTGTTGAAGAATGGGATGTTATCGAAAAGCCAATTCTGCCACTACAGTACACTAGAGGACCTGGAAGGCCTAAATTCTCAAGAAACAAAGAACCAGATGAGCAACGTCTACCACCTCCTGGAACCACTAAGCCACCTTCTGGAACTGAGAAGTTACCAAAGGCTTACTATCAAGGAATTACATGTGGACGATGCCATAAGAAAGGGCATAATAGCAGAACTTGTGCAAGAAGAGAAGCACAGTCCCAAACAAGGATTGAATCACCACCTTCTCAAAACTATGGAAATGATGTGCATGTTGATCAAGCTTCACATGATGACAATCAAATACCTATGAGAATTCAGCGCAACAAAGCCCCTGCACCAAATGAAAGATCTCAGCGCAAGCCAAATTGGAAGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.53

Weight (kDa)

9.71

Isoelectric Point (pI)

62.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 35, 155, 176
AccI GTMKAC 1 cut(s) 145
AcsI RAATTY 2 cut(s) 110, 375
AfaI GTAC 1 cut(s) 86
AfiI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 2 cut(s) 44, 296
AjnI CCWGG 3 cut(s) 34, 97, 154
AluBI AGCT 1 cut(s) 344
AluI AGCT 1 cut(s) 344
AoxI GGCC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 110, 375
AspLEI GCGC 2 cut(s) 384, 420
AspS9I GGNCC 2 cut(s) 14, 95
AsuHPI GGTGA 1 cut(s) 291
AvaII GGWCC 2 cut(s) 14, 95
BciT130I CCWGG 3 cut(s) 36, 99, 156
BclI TGATCA 1 cut(s) 337
BfaI CTAG 1 cut(s) 90
BfmI CTRYAG 1 cut(s) 80
BglII AGATCT 1 cut(s) 410
Bme1390I CCNGG 3 cut(s) 36, 99, 156
Bme18I GGWCC 2 cut(s) 14, 95
BmgT120I GGNCC 2 cut(s) 14, 95
BmiI GGNNCC 1 cut(s) 160
BmrFI CCNGG 3 cut(s) 36, 99, 156
BmsI GCATC 1 cut(s) 218
BpuEI CTTGAG 1 cut(s) 100
BsaBI GATNNNNATC 1 cut(s) 357
Bsc4I CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
Bse8I GATNNNNATC 1 cut(s) 357
BseBI CCWGG 3 cut(s) 36, 99, 156
BseGI GGATG 1 cut(s) 58
BseJI GATNNNNATC 1 cut(s) 357
BseLI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
BseMII CTCAG 2 cut(s) 174, 428
BsgI GTGCAG 1 cut(s) 381
BshFI GGCC 1 cut(s) 106
BslFI GGGAC 1 cut(s) 265
BslI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
BsmFI GGGAC 1 cut(s) 265
BsnI GGCC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 337, 410
BspANI GGCC 1 cut(s) 106
BspCNI CTCAG 2 cut(s) 175, 427
BspLI GGNNCC 1 cut(s) 160
BssMI GATC 2 cut(s) 337, 410
Bst2UI CCWGG 3 cut(s) 36, 99, 156
Bst4CI ACNGT 2 cut(s) 84, 279
Bst6I CTCTTC 1 cut(s) 262
BstC8I GCNNGC 2 cut(s) 6, 422
BstDEI CTNAG 3 cut(s) 165, 183, 414
BstF5I GGATG 1 cut(s) 58
BstHHI GCGC 2 cut(s) 384, 420
BstKTI GATC 2 cut(s) 340, 413
BstMBI GATC 2 cut(s) 337, 410
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstNI CCWGG 3 cut(s) 36, 99, 156
BstNSI RCATGY 2 cut(s) 222, 335
BstSCI CCNGG 3 cut(s) 34, 97, 154
BstSFI CTRYAG 1 cut(s) 80
BstX2I RGATCY 1 cut(s) 410
BstYI RGATCY 1 cut(s) 410
BsuRI GGCC 1 cut(s) 106
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 2 cut(s) 6, 422
CfoI GCGC 2 cut(s) 384, 420
Cfr13I GGNCC 2 cut(s) 14, 95
Csp6I GTAC 1 cut(s) 85
CviAII CATG 4 cut(s) 219, 332, 350, 438
CviJI RGCY 9 cut(s) 20, 67, 106, 169, 200, 344, 392, 424, 436
CviKI_1 RGCY 9 cut(s) 20, 67, 106, 169, 200, 344, 392, 424, 436
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 3 cut(s) 165, 183, 414
DpnI GATC 2 cut(s) 339, 412
DpnII GATC 2 cut(s) 337, 410
Eam1104I CTCTTC 1 cut(s) 262
EarI CTCTTC 1 cut(s) 262
Eco147I AGGCCT 1 cut(s) 106
Eco47I GGWCC 2 cut(s) 14, 95
EcoO109I RGGNCCY 1 cut(s) 95
EcoRI GAATTC 1 cut(s) 375
EcoRII CCWGG 3 cut(s) 34, 97, 154
FaeI CATG 4 cut(s) 222, 335, 353, 441
FaqI GGGAC 1 cut(s) 265
FatI CATG 4 cut(s) 218, 331, 349, 437
FauNDI CATATG 1 cut(s) 10
FbaI TGATCA 1 cut(s) 337
FblI GTMKAC 1 cut(s) 145
FokI GGATG 1 cut(s) 65
FspBI CTAG 1 cut(s) 90
GlaI GCGC 2 cut(s) 383, 419
HaeIII GGCC 1 cut(s) 106
HhaI GCGC 2 cut(s) 384, 420
Hin1II CATG 4 cut(s) 222, 335, 353, 441
Hin6I GCGC 2 cut(s) 382, 418
HinP1I GCGC 2 cut(s) 382, 418
HindIII AAGCTT 1 cut(s) 342
HinfI GANTC 1 cut(s) 296
HphI GGTGA 1 cut(s) 291
Hpy166II GTNNAC 3 cut(s) 87, 146, 224
Hpy188III TCNNGA 2 cut(s) 117, 177
Hpy8I GTNNAC 3 cut(s) 87, 146, 224
HpyAV CCTTC 3 cut(s) 96, 183, 315
HpyCH4III ACNGT 2 cut(s) 84, 279
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 4 cut(s) 8, 263, 331, 398
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 3 cut(s) 165, 183, 414
HpySE526I ACGT 1 cut(s) 142
Hsp92II CATG 4 cut(s) 222, 335, 353, 441
HspAI GCGC 2 cut(s) 382, 418
Ksp22I TGATCA 1 cut(s) 337
Kzo9I GATC 2 cut(s) 337, 410
LweI GCATC 1 cut(s) 218
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 189
MalI GATC 2 cut(s) 339, 412
MboI GATC 2 cut(s) 337, 410
MboII GAAGA 2 cut(s) 56, 279
MflI RGATCY 1 cut(s) 410
MluCI AATT 6 cut(s) 30, 69, 110, 213, 375, 427
MnlI CCTC 2 cut(s) 86, 162
MspR9I CCNGG 3 cut(s) 36, 99, 156
MvaI CCWGG 3 cut(s) 36, 99, 156
MwoI GCNNNNNNNGC 1 cut(s) 73
NdeI CATATG 1 cut(s) 10
NdeII GATC 2 cut(s) 337, 410
NlaIII CATG 4 cut(s) 222, 335, 353, 441
NlaIV GGNNCC 1 cut(s) 160
NspI RCATGY 2 cut(s) 222, 335
PceI AGGCCT 1 cut(s) 106
PciI ACATGT 1 cut(s) 218
PfeI GAWTC 1 cut(s) 296
PflMI CCANNNNNTGG 3 cut(s) 35, 155, 176
PfoI TCCNGGA 1 cut(s) 154
PpuMI RGGWCCY 1 cut(s) 95
PscI ACATGT 1 cut(s) 218
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 3 cut(s) 34, 97, 154
PspGI CCWGG 3 cut(s) 34, 97, 154
PspN4I GGNNCC 1 cut(s) 160
PspPI GGNCC 2 cut(s) 14, 95
PspPPI RGGWCCY 1 cut(s) 95
PsuI RGATCY 1 cut(s) 410
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
Sau3AI GATC 2 cut(s) 337, 410
Sau96I GGNCC 2 cut(s) 14, 95
ScrFI CCNGG 3 cut(s) 36, 99, 156
SetI ASST 7 cut(s) 100, 145, 154, 175, 307, 346, 370
SfaNI GCATC 1 cut(s) 218
SfcI CTRYAG 1 cut(s) 80
SinI GGWCC 2 cut(s) 14, 95
SmlI CTYRAG 1 cut(s) 115
SmoI CTYRAG 1 cut(s) 115
Sse9I AATT 6 cut(s) 30, 69, 110, 213, 375, 427
SseBI AGGCCT 1 cut(s) 106
SspMI CTAG 1 cut(s) 90
StuI AGGCCT 1 cut(s) 106
StyD4I CCNGG 3 cut(s) 34, 97, 154
TaaI ACNGT 2 cut(s) 84, 279
TaiI ACGT 1 cut(s) 145
TaqI TCGA 1 cut(s) 60
TasI AATT 6 cut(s) 30, 69, 110, 213, 375, 427
TatI WGTACW 1 cut(s) 84
TfiI GAWTC 1 cut(s) 296
TspDTI ATGAA 1 cut(s) 420
Van91I CCANNNNNTGG 3 cut(s) 35, 155, 176
VpaK11BI GGWCC 2 cut(s) 14, 95
XapI RAATTY 2 cut(s) 110, 375
XceI RCATGY 2 cut(s) 222, 335
XmiI GTMKAC 1 cut(s) 145
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.