Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Contig00223

Orthogroup ID

OG0000691

Physical Location & Seq

Genomic Coordinates Forward (+)

45165 .. 49225

Gene Structure 4061 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw0G005630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 423 bp

ATGCTTGCATATGAACCTGCAATAAACCCAATCCCTGGTGTTGATGAATGGGAGGTTGTTGAGAGGCCCATTTTACCTCCAAGGTACACTAGAGGACCTGGAAGGCCTAAGCTATCAAGAAACAAGGAACCAGGTGAGCAAGCACCACCTCCTGGAACAACCAAGTTGTCAAGAAGTTACCATCAGTCCATTACTTGTTCAGTTTGTAAAAAAGATGGCCATAATAAGAGGACTTGTTCAAGGAGACAGCAACAAGGCAATGATTCCCAAGCTGGGGTTCAACCATCAGAAACTGATGATCAGAGTGTCCATGTGGAGCAAGCTGAAAATCCTAAGCCTAAACTTGTGATAGGAACAAGCACTAAAGCAAGAGCCCAACAAGGACCAAAGGAGGGTTCCAACAAGAAAATTTGGAAGCCGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DBD_Tnp_Mut MULE SWIM

Protein Analysis

140

Amino Acids

15.5

Weight (kDa)

9.6

Isoelectric Point (pI)

57.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000691)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g09131 FvH4_5g29241 FvH4_5g38700 FvH4_6g10171 FvH4_6g31671 FvH4_7g25602
rosa_chinensis	RchiOBHm_Chr3g0477061 RchiOBHm_Chr5g0037961 RchiOBHm_Chr5g0045201 RchiOBHm_Chr5g0075681 RchiOBHm_Chr6g0255251 RchiOBHm_Chr6g0276481 RchiOBHm_Chr7g0188661 RchiOBHm_Chr7g0212591
rosa_laevigata	RLG00000014285 RLG00000019737 RLG00000020231 RLG00000027687 RLG00000028530 RLG00000029679
rosa_multiflora	Rmu_sc0008577.1_g000011 Rmu_sc0010616.1_g000005 Rmu_ssc0000255.1_g000048
rosa_roxburghii	Rroxscaffold_1G00039250 Rroxscaffold_2G00087850 Rroxscaffold_3G00231610 Rroxscaffold_3G00276260 Rroxscaffold_3G00276270
rosa_rugosa	Rorug01G0345200.1 Rorug02G0070900 Rorug03G0279300
rosa_samantha	Rh1AG087400 Rh1AG177300 Rh1BG218300 Rh1CG085600 Rh1CG164600 Rh1CG231700 Rh1CG234900 Rh1DG092000 Rh1DG244700 Rh3AG293200 Rh3BG241800 Rh3CG102600 Rh3CG163100 Rh3CG278400 Rh3DG163700 Rh3DG208200 Rh4AG190800 Rh4DG072100 Rh5AG271800 Rh5BG011900 Rh5BG311500 Rh5CG245000 Rh5CG402400 Rh5DG009700 Rh5DG321700 Rh6BG065700 Rh6BG431400 Rh6CG449000 Rh6DG208800 Rh7AG267300 Rh7BG437400 Rh7CG285800 Rh7CG418900 Rh7CG450100 Rh7DG275300
rosa_wichuraiana	Rw0G005630 Rw0G009300 Rw0G023360 Rw1G017030 Rw1G017050 Rw4G035810 Rw6G031650 Rw7G008390 Rw7G022990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	25
AccB7I	CCANNNNNTGG	2 cut(s)	35, 152
AcoI	YGGCCR	1 cut(s)	217
AcsI	RAATTY	1 cut(s)	408
AfaI	GTAC	1 cut(s)	86
AfiI	CCNNNNNNNGG	5 cut(s)	35, 152, 273, 274, 392
AgsI	TTSAA	2 cut(s)	240, 281
AjnI	CCWGG	4 cut(s)	34, 97, 130, 151
AjuI	GAANNNNNNNTTGG	4 cut(s)	261, 293, 379, 411
AluBI	AGCT	3 cut(s)	112, 272, 323
AluI	AGCT	3 cut(s)	112, 272, 323
Alw26I	GTCTC	1 cut(s)	238
AlwNI	CAGNNNCTG	1 cut(s)	293
AoxI	GGCC	3 cut(s)	65, 104, 217
ApoI	RAATTY	1 cut(s)	408
AspS9I	GGNCC	3 cut(s)	66, 95, 383
AsuHPI	GGTGA	1 cut(s)	146
AvaII	GGWCC	2 cut(s)	95, 383
BalI	TGGCCA	1 cut(s)	219
BanII	GRGCYC	1 cut(s)	376
BccI	CCATC	3 cut(s)	189, 209, 292
BceAI	ACGGC	1 cut(s)	403
BciT130I	CCWGG	4 cut(s)	36, 99, 132, 153
BclI	TGATCA	1 cut(s)	298
BcoDI	GTCTC	1 cut(s)	238
BfaI	CTAG	1 cut(s)	90
BfuAI	ACCTGC	1 cut(s)	25
Bme1390I	CCNGG	4 cut(s)	36, 99, 132, 153
Bme18I	GGWCC	2 cut(s)	95, 383
BmgT120I	GGNCC	3 cut(s)	66, 95, 383
BmiI	GGNNCC	2 cut(s)	129, 397
BmrFI	CCNGG	4 cut(s)	36, 99, 132, 153
Bpu10I	CCTNAGC	2 cut(s)	108, 333
BsaJI	CCNNGG	2 cut(s)	34, 80
Bsc4I	CCNNNNNNNGG	5 cut(s)	35, 152, 273, 274, 392
Bse3DI	GCAATG	1 cut(s)	265
BseBI	CCWGG	4 cut(s)	36, 99, 132, 153
BseDI	CCNNGG	2 cut(s)	34, 80
BseLI	CCNNNNNNNGG	5 cut(s)	35, 152, 273, 274, 392
BseMI	GCAATG	1 cut(s)	265
BseYI	CCCAGC	1 cut(s)	272
BshFI	GGCC	3 cut(s)	67, 106, 219
BslI	CCNNNNNNNGG	5 cut(s)	35, 152, 273, 274, 392
BsmAI	GTCTC	1 cut(s)	238
BsnI	GGCC	3 cut(s)	67, 106, 219
Bsp1286I	GDGCHC	1 cut(s)	376
Bsp143I	GATC	1 cut(s)	298
BspANI	GGCC	3 cut(s)	67, 106, 219
BspLI	GGNNCC	2 cut(s)	129, 397
BspMI	ACCTGC	1 cut(s)	25
BsrDI	GCAATG	1 cut(s)	265
BssECI	CCNNGG	2 cut(s)	34, 80
BssMI	GATC	1 cut(s)	298
BssT1I	CCWWGG	1 cut(s)	80
Bst2UI	CCWGG	4 cut(s)	36, 99, 132, 153
BstC8I	GCNNGC	3 cut(s)	6, 141, 321
BstDEI	CTNAG	2 cut(s)	108, 333
BstKTI	GATC	1 cut(s)	301
BstMAI	GTCTC	1 cut(s)	238
BstMBI	GATC	1 cut(s)	298
BstNI	CCWGG	4 cut(s)	36, 99, 132, 153
BstSCI	CCNGG	4 cut(s)	34, 97, 130, 151
BsuRI	GGCC	3 cut(s)	67, 106, 219
BveI	ACCTGC	1 cut(s)	25
Cac8I	GCNNGC	3 cut(s)	6, 141, 321
CaiI	CAGNNNCTG	1 cut(s)	293
Cfr13I	GGNCC	3 cut(s)	66, 95, 383
CsiI	ACCWGGT	1 cut(s)	130
Csp6I	GTAC	1 cut(s)	85
CviAII	CATG	1 cut(s)	311
CviJI	RGCY	9 cut(s)	67, 106, 112, 219, 272, 323, 337, 374, 418
CviKI_1	RGCY	9 cut(s)	67, 106, 112, 219, 272, 323, 337, 374, 418
CviQI	GTAC	1 cut(s)	85
DdeI	CTNAG	2 cut(s)	108, 333
DpnI	GATC	1 cut(s)	300
DpnII	GATC	1 cut(s)	298
EaeI	YGGCCR	1 cut(s)	217
Eco130I	CCWWGG	1 cut(s)	80
Eco147I	AGGCCT	1 cut(s)	106
Eco24I	GRGCYC	1 cut(s)	376
Eco47I	GGWCC	2 cut(s)	95, 383
EcoO109I	RGGNCCY	1 cut(s)	95
EcoRII	CCWGG	4 cut(s)	34, 97, 130, 151
EcoT14I	CCWWGG	1 cut(s)	80
EcoT38I	GRGCYC	1 cut(s)	376
ErhI	CCWWGG	1 cut(s)	80
FaeI	CATG	1 cut(s)	314
FaiI	YATR	4 cut(s)	10, 12, 222, 312
FatI	CATG	1 cut(s)	310
FauNDI	CATATG	1 cut(s)	10
FbaI	TGATCA	1 cut(s)	298
FriOI	GRGCYC	1 cut(s)	376
FspBI	CTAG	1 cut(s)	90
GsaI	CCCAGC	1 cut(s)	276
HaeIII	GGCC	3 cut(s)	67, 106, 219
Hin1II	CATG	1 cut(s)	314
HinfI	GANTC	1 cut(s)	263
HphI	GGTGA	1 cut(s)	146
Hpy166II	GTNNAC	1 cut(s)	87
Hpy188I	TCNGA	2 cut(s)	289, 303
Hpy188III	TCNNGA	2 cut(s)	117, 171
Hpy8I	GTNNAC	1 cut(s)	87
HpyAV	CCTTC	1 cut(s)	96
HpyCH4V	TGCA	2 cut(s)	8, 20
HpyF3I	CTNAG	2 cut(s)	108, 333
Hsp92II	CATG	1 cut(s)	314
Ksp22I	TGATCA	1 cut(s)	298
Kzo9I	GATC	1 cut(s)	298
LmnI	GCTCC	1 cut(s)	316
MabI	ACCWGGT	1 cut(s)	130
MaeI	CTAG	1 cut(s)	90
MaeIII	GTNAC	1 cut(s)	176
MalI	GATC	1 cut(s)	300
MboI	GATC	1 cut(s)	298
MhlI	GDGCHC	1 cut(s)	376
MlsI	TGGCCA	1 cut(s)	219
MluCI	AATT	1 cut(s)	408
MluNI	TGGCCA	1 cut(s)	219
MmeI	TCCRAC	1 cut(s)	423
MnlI	CCTC	7 cut(s)	46, 57, 86, 87, 159, 222, 385
Mox20I	TGGCCA	1 cut(s)	219
MscI	TGGCCA	1 cut(s)	219
Msp20I	TGGCCA	1 cut(s)	219
MspR9I	CCNGG	4 cut(s)	36, 99, 132, 153
MvaI	CCWGG	4 cut(s)	36, 99, 132, 153
NdeI	CATATG	1 cut(s)	10
NdeII	GATC	1 cut(s)	298
NlaIII	CATG	1 cut(s)	314
NlaIV	GGNNCC	2 cut(s)	129, 397
PceI	AGGCCT	1 cut(s)	106
PfeI	GAWTC	1 cut(s)	263
PflMI	CCANNNNNTGG	2 cut(s)	35, 152
PfoI	TCCNGGA	1 cut(s)	151
PpuMI	RGGWCCY	1 cut(s)	95
Psp5II	RGGWCCY	1 cut(s)	95
Psp6I	CCWGG	4 cut(s)	34, 97, 130, 151
PspFI	CCCAGC	1 cut(s)	272
PspGI	CCWGG	4 cut(s)	34, 97, 130, 151
PspN4I	GGNNCC	2 cut(s)	129, 397
PspPI	GGNCC	3 cut(s)	66, 95, 383
PspPPI	RGGWCCY	1 cut(s)	95
PstNI	CAGNNNCTG	1 cut(s)	293
RsaI	GTAC	1 cut(s)	86
RsaNI	GTAC	1 cut(s)	85
Sau3AI	GATC	1 cut(s)	298
Sau96I	GGNCC	3 cut(s)	66, 95, 383
ScrFI	CCNGG	4 cut(s)	36, 99, 132, 153
SduI	GDGCHC	1 cut(s)	376
SexAI	ACCWGGT	1 cut(s)	130
SinI	GGWCC	2 cut(s)	95, 383
Sse9I	AATT	1 cut(s)	408
SseBI	AGGCCT	1 cut(s)	106
SspMI	CTAG	1 cut(s)	90
StuI	AGGCCT	1 cut(s)	106
StyD4I	CCNGG	4 cut(s)	34, 97, 130, 151
StyI	CCWWGG	1 cut(s)	80
TasI	AATT	1 cut(s)	408
TfiI	GAWTC	1 cut(s)	263
TspDTI	ATGAA	2 cut(s)	27, 60
Van91I	CCANNNNNTGG	2 cut(s)	35, 152
VpaK11BI	GGWCC	2 cut(s)	95, 383
XapI	RAATTY	1 cut(s)	408
XspI	CTAG	1 cut(s)	90

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.