Rw1G017050

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000691
Physical Location & Seq
Forward (+)
37849902 .. 37850884
983 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G017050.1

Sequence Viewer

Length: 417 bp
ATGCTTGCATACGGTCCAGCCATAAACCCAATTCCTGGTGTTGAAGAATGGGATGTTATCGAAAAGCCAATTCTGCCACCACAGTACACTAGAGGACCTGGAAGGCCTAAATTCTCAAGAAACAAAGAACCAGATGAGCAACGTCTACCACCTCCTGGAACCACTAAGCCACCTTCTGGAATTGAGAAGTTACCAAGGGCTTACTATCAAGGAATTACATGTGGACGATGCCAGAAGAAAGGGCATAATAGCAGAACTTGTGCAAGAAGAGAAGCACAGTCCCAAACAAGGATTGAATCACCACCTTCTCAAAACTATGGAAATGATGTGCATGTTGGTCAAGCTTCACATGATGACAATCAAATACCTATGAGAATTCAGTTCAACAAAGCCCCTGCACCAAATGAAAGATCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

138

Amino Acids

15.44

Weight (kDa)

9.43

Isoelectric Point (pI)

62.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 35, 155, 176
AccI GTMKAC 1 cut(s) 145
AcsI RAATTY 2 cut(s) 110, 375
AfaI GTAC 1 cut(s) 86
AfiI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 3 cut(s) 44, 296, 385
AjnI CCWGG 3 cut(s) 34, 97, 154
AluBI AGCT 1 cut(s) 344
AluI AGCT 1 cut(s) 344
AoxI GGCC 1 cut(s) 104
ApoI RAATTY 2 cut(s) 110, 375
AspS9I GGNCC 2 cut(s) 14, 95
AsuHPI GGTGA 1 cut(s) 291
AvaII GGWCC 2 cut(s) 14, 95
BciT130I CCWGG 3 cut(s) 36, 99, 156
BfaI CTAG 1 cut(s) 90
BglII AGATCT 1 cut(s) 410
Bme1390I CCNGG 3 cut(s) 36, 99, 156
Bme18I GGWCC 2 cut(s) 14, 95
BmgT120I GGNCC 2 cut(s) 14, 95
BmiI GGNNCC 1 cut(s) 160
BmrFI CCNGG 3 cut(s) 36, 99, 156
BmsI GCATC 1 cut(s) 218
BpuEI CTTGAG 1 cut(s) 100
BsaBI GATNNNNATC 1 cut(s) 357
BsaJI CCNNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
Bse8I GATNNNNATC 1 cut(s) 357
BseBI CCWGG 3 cut(s) 36, 99, 156
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 58
BseJI GATNNNNATC 1 cut(s) 357
BseLI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
BsgI GTGCAG 1 cut(s) 381
BshFI GGCC 1 cut(s) 106
BslFI GGGAC 1 cut(s) 265
BslI CCNNNNNNNGG 4 cut(s) 35, 155, 176, 288
BsmFI GGGAC 1 cut(s) 265
BsnI GGCC 1 cut(s) 106
Bsp143I GATC 1 cut(s) 410
BspANI GGCC 1 cut(s) 106
BspLI GGNNCC 1 cut(s) 160
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 1 cut(s) 410
BssT1I CCWWGG 1 cut(s) 194
Bst2UI CCWGG 3 cut(s) 36, 99, 156
Bst4CI ACNGT 3 cut(s) 14, 84, 279
Bst6I CTCTTC 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 165, 414
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 413
BstMBI GATC 1 cut(s) 410
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstNI CCWGG 3 cut(s) 36, 99, 156
BstNSI RCATGY 2 cut(s) 222, 335
BstSCI CCNGG 3 cut(s) 34, 97, 154
BstX2I RGATCY 1 cut(s) 410
BstYI RGATCY 1 cut(s) 410
BsuRI GGCC 1 cut(s) 106
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 14, 95
Csp6I GTAC 1 cut(s) 85
CviAII CATG 3 cut(s) 219, 332, 350
CviJI RGCY 7 cut(s) 20, 67, 106, 169, 200, 344, 392
CviKI_1 RGCY 7 cut(s) 20, 67, 106, 169, 200, 344, 392
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 2 cut(s) 165, 414
DpnI GATC 1 cut(s) 412
DpnII GATC 1 cut(s) 410
Eam1104I CTCTTC 1 cut(s) 262
EarI CTCTTC 1 cut(s) 262
Eco130I CCWWGG 1 cut(s) 194
Eco147I AGGCCT 1 cut(s) 106
Eco47I GGWCC 2 cut(s) 14, 95
EcoO109I RGGNCCY 1 cut(s) 95
EcoRI GAATTC 1 cut(s) 375
EcoRII CCWGG 3 cut(s) 34, 97, 154
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 3 cut(s) 222, 335, 353
FaiI YATR 8 cut(s) 10, 23, 220, 246, 318, 333, 351, 371
FaqI GGGAC 1 cut(s) 265
FatI CATG 3 cut(s) 218, 331, 349
FblI GTMKAC 1 cut(s) 145
FokI GGATG 1 cut(s) 65
FspBI CTAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 106
Hin1II CATG 3 cut(s) 222, 335, 353
HindIII AAGCTT 1 cut(s) 342
HinfI GANTC 1 cut(s) 296
HphI GGTGA 1 cut(s) 291
Hpy166II GTNNAC 3 cut(s) 87, 146, 224
Hpy188III TCNNGA 2 cut(s) 117, 177
Hpy8I GTNNAC 3 cut(s) 87, 146, 224
HpyAV CCTTC 3 cut(s) 96, 183, 315
HpyCH4III ACNGT 3 cut(s) 14, 84, 279
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 4 cut(s) 8, 263, 331, 398
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 2 cut(s) 165, 414
HpySE526I ACGT 1 cut(s) 142
Hsp92II CATG 3 cut(s) 222, 335, 353
Kzo9I GATC 1 cut(s) 410
LweI GCATC 1 cut(s) 218
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 189
MalI GATC 1 cut(s) 412
MboI GATC 1 cut(s) 410
MboII GAAGA 3 cut(s) 56, 247, 279
MflI RGATCY 1 cut(s) 410
MluCI AATT 6 cut(s) 30, 69, 110, 180, 213, 375
MnlI CCTC 2 cut(s) 86, 162
MspR9I CCNGG 3 cut(s) 36, 99, 156
MvaI CCWGG 3 cut(s) 36, 99, 156
MwoI GCNNNNNNNGC 1 cut(s) 73
NdeII GATC 1 cut(s) 410
NlaIII CATG 3 cut(s) 222, 335, 353
NlaIV GGNNCC 1 cut(s) 160
NspI RCATGY 2 cut(s) 222, 335
PceI AGGCCT 1 cut(s) 106
PciI ACATGT 1 cut(s) 218
PfeI GAWTC 1 cut(s) 296
PflMI CCANNNNNTGG 3 cut(s) 35, 155, 176
PfoI TCCNGGA 1 cut(s) 154
PpuMI RGGWCCY 1 cut(s) 95
PscI ACATGT 1 cut(s) 218
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 3 cut(s) 34, 97, 154
PspGI CCWGG 3 cut(s) 34, 97, 154
PspN4I GGNNCC 1 cut(s) 160
PspPI GGNCC 2 cut(s) 14, 95
PspPPI RGGWCCY 1 cut(s) 95
PsuI RGATCY 1 cut(s) 410
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
Sau3AI GATC 1 cut(s) 410
Sau96I GGNCC 2 cut(s) 14, 95
ScrFI CCNGG 3 cut(s) 36, 99, 156
SetI ASST 7 cut(s) 100, 145, 154, 175, 307, 346, 370
SfaNI GCATC 1 cut(s) 218
SinI GGWCC 2 cut(s) 14, 95
SmlI CTYRAG 1 cut(s) 115
SmoI CTYRAG 1 cut(s) 115
Sse9I AATT 6 cut(s) 30, 69, 110, 180, 213, 375
SseBI AGGCCT 1 cut(s) 106
SspMI CTAG 1 cut(s) 90
StuI AGGCCT 1 cut(s) 106
StyD4I CCNGG 3 cut(s) 34, 97, 154
StyI CCWWGG 1 cut(s) 194
TaaI ACNGT 3 cut(s) 14, 84, 279
TaiI ACGT 1 cut(s) 145
TaqI TCGA 1 cut(s) 60
TasI AATT 6 cut(s) 30, 69, 110, 180, 213, 375
TatI WGTACW 1 cut(s) 84
TfiI GAWTC 1 cut(s) 296
Van91I CCANNNNNTGG 3 cut(s) 35, 155, 176
VpaK11BI GGWCC 2 cut(s) 14, 95
XapI RAATTY 2 cut(s) 110, 375
XceI RCATGY 2 cut(s) 222, 335
XmiI GTMKAC 1 cut(s) 145
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.