Rh3CG163100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0000691
Physical Location & Seq
Forward (+)
13721113 .. 13721562
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG163100.1

Sequence Viewer

Length: 345 bp
ATGGAGCAAGCTGAAAATGTTCAAAGTGATGTGCATGTTGAAAGTGATATGCATTATGGATCAGTGCAGCAAACTGCAAATGTACCAACACCCTCAATTGTTGCAAGTGCTTCATCTCAACCGATGATCTCATCACCACCTCTACCTCAGTCTTCTTTGCAGCCCACTGTTATCGGATCATCTCATACGTCCAGGACATTTGTATGTCCTAAGACAGGGATGCCATTCAAGACCAAGTCAATAGCACATAAGCCTAAGCCTAAACTTGTGATAGGAACAAGCACTAAAGCAAGAGCCCAACAAGGACCAAAGGAGGGTTCCAACAAGAAAATTTGGAAGCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

12.21

Weight (kDa)

9.87

Isoelectric Point (pI)

64.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 67, 184
AcsI RAATTY 1 cut(s) 330
AfaI GTAC 1 cut(s) 84
AfiI CCNNNNNNNGG 2 cut(s) 215, 314
AgsI TTSAA 3 cut(s) 23, 41, 229
AjnI CCWGG 1 cut(s) 191
AjuI GAANNNNNNNTTGG 2 cut(s) 301, 333
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 2 cut(s) 67, 184
ApeKI GCWGC 2 cut(s) 67, 160
ApoI RAATTY 1 cut(s) 330
Asp700I GAANNNNTTC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 305
AsuHPI GGTGA 1 cut(s) 126
AvaII GGWCC 1 cut(s) 305
BanII GRGCYC 1 cut(s) 298
BbsI GAAGAC 1 cut(s) 144
BbvI GCAGC 2 cut(s) 79, 172
BceAI ACGGC 1 cut(s) 325
BciT130I CCWGG 1 cut(s) 193
BisI GCNGC 2 cut(s) 68, 161
BlsI GCNGC 2 cut(s) 69, 162
Bme1390I CCNGG 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 305
BmgT120I GGNCC 1 cut(s) 305
BmiI GGNNCC 1 cut(s) 319
BmrFI CCNGG 1 cut(s) 193
BmsI GCATC 1 cut(s) 210
BpiI GAAGAC 1 cut(s) 144
Bpu10I CCTNAGC 1 cut(s) 255
Bsc4I CCNNNNNNNGG 2 cut(s) 215, 314
BseBI CCWGG 1 cut(s) 193
BseGI GGATG 1 cut(s) 225
BseLI CCNNNNNNNGG 2 cut(s) 215, 314
BseMII CTCAG 1 cut(s) 161
BseXI GCAGC 2 cut(s) 79, 172
BsgI GTGCAG 1 cut(s) 86
BslI CCNNNNNNNGG 2 cut(s) 215, 314
Bsp1286I GDGCHC 1 cut(s) 298
Bsp143I GATC 3 cut(s) 59, 126, 176
BspCNI CTCAG 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 319
BspPI GGATC 2 cut(s) 67, 184
BssMI GATC 3 cut(s) 59, 126, 176
Bst2UI CCWGG 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 9
BstDEI CTNAG 3 cut(s) 147, 210, 255
BstENI CCTNNNNNAGG 1 cut(s) 213
BstF5I GGATG 1 cut(s) 225
BstKTI GATC 3 cut(s) 62, 129, 179
BstMBI GATC 3 cut(s) 59, 126, 176
BstNI CCWGG 1 cut(s) 193
BstNSI RCATGY 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 191
BstV1I GCAGC 2 cut(s) 79, 172
BstV2I GAAGAC 1 cut(s) 144
BtsCI GGATG 1 cut(s) 225
BtsIMutI CAGTG 2 cut(s) 69, 165
Cac8I GCNNGC 1 cut(s) 9
Cfr13I GGNCC 1 cut(s) 305
Csp6I GTAC 1 cut(s) 83
CviAII CATG 1 cut(s) 35
CviJI RGCY 6 cut(s) 11, 163, 253, 259, 296, 340
CviKI_1 RGCY 6 cut(s) 11, 163, 253, 259, 296, 340
CviQI GTAC 1 cut(s) 83
DdeI CTNAG 3 cut(s) 147, 210, 255
DpnI GATC 3 cut(s) 61, 128, 178
DpnII GATC 3 cut(s) 59, 126, 176
Eco24I GRGCYC 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 305
EcoNI CCTNNNNNAGG 1 cut(s) 213
EcoRII CCWGG 1 cut(s) 191
EcoT22I ATGCAT 1 cut(s) 54
EcoT38I GRGCYC 1 cut(s) 298
FaeI CATG 1 cut(s) 38
FaiI YATR 6 cut(s) 36, 50, 57, 186, 205, 249
FatI CATG 1 cut(s) 34
Fnu4HI GCNGC 2 cut(s) 68, 161
FokI GGATG 1 cut(s) 232
FriOI GRGCYC 1 cut(s) 298
Fsp4HI GCNGC 2 cut(s) 68, 161
GluI GCNGC 2 cut(s) 68, 161
Hin1II CATG 1 cut(s) 38
HphI GGTGA 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 229
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 6 cut(s) 34, 52, 67, 77, 104, 160
HpyF3I CTNAG 3 cut(s) 147, 210, 255
HpySE526I ACGT 1 cut(s) 188
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 3 cut(s) 59, 126, 176
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 178, 201, 205
Lsp1109I GCAGC 2 cut(s) 79, 172
LweI GCATC 1 cut(s) 210
MaeII ACGT 1 cut(s) 188
MalI GATC 3 cut(s) 61, 128, 178
MboI GATC 3 cut(s) 59, 126, 176
MboII GAAGA 1 cut(s) 144
MfeI CAATTG 1 cut(s) 96
MhlI GDGCHC 1 cut(s) 298
MluCI AATT 2 cut(s) 96, 330
MmeI TCCRAC 1 cut(s) 345
MnlI CCTC 4 cut(s) 103, 150, 156, 307
Mph1103I ATGCAT 1 cut(s) 54
MroXI GAANNNNTTC 1 cut(s) 18
MslI CAYNNNNRTG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 193
MunI CAATTG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 193
NdeII GATC 3 cut(s) 59, 126, 176
NlaIII CATG 1 cut(s) 38
NlaIV GGNNCC 1 cut(s) 319
NsiI ATGCAT 1 cut(s) 54
NspI RCATGY 1 cut(s) 38
PdmI GAANNNNTTC 1 cut(s) 18
PflFI GACNNNGTC 1 cut(s) 235
PfoI TCCNGGA 1 cut(s) 191
PkrI GCNGC 2 cut(s) 69, 162
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 319
PspPI GGNCC 1 cut(s) 305
PsyI GACNNNGTC 1 cut(s) 235
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 202
SatI GCNGC 2 cut(s) 68, 161
Sau3AI GATC 3 cut(s) 59, 126, 176
Sau96I GGNCC 1 cut(s) 305
ScrFI CCNGG 1 cut(s) 193
SduI GDGCHC 1 cut(s) 298
SetI ASST 4 cut(s) 13, 142, 148, 191
SfaNI GCATC 1 cut(s) 210
SinI GGWCC 1 cut(s) 305
SmiMI CAYNNNNRTG 1 cut(s) 202
Sse9I AATT 2 cut(s) 96, 330
StyD4I CCNGG 1 cut(s) 191
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 1 cut(s) 191
TasI AATT 2 cut(s) 96, 330
TscAI CASTG 2 cut(s) 69, 172
TseI GCWGC 2 cut(s) 67, 160
TspDTI ATGAA 1 cut(s) 102
TspRI CASTG 2 cut(s) 69, 172
Tth111I GACNNNGTC 1 cut(s) 235
VpaK11BI GGWCC 1 cut(s) 305
XagI CCTNNNNNAGG 1 cut(s) 213
XapI RAATTY 1 cut(s) 330
XceI RCATGY 1 cut(s) 38
XmnI GAANNNNTTC 1 cut(s) 18
Zsp2I ATGCAT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.