Rroxscaffold_1G00039250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000691
Physical Location & Seq
Reverse (-)
56854280 .. 56859060
4781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00039250.1

Sequence Viewer

Length: 219 bp
ATGGAAGTGCATCATAAGATTCCATCTCAACAATCACTTGTGGAATCTCCTTTTGTTTCATCACAACCACTTCCATCACCTCTAAATTTCTTACAAGAAATTCCTCCAGTTCAAAGAAGTTCTCAACCTATTGGATCATTATCGCCTTCCTTCTCCATCATTTACACCGATCCTCAGAATCGGGAGGCCAAAGAAGCAAGTTGCATTCAGAAATCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.97

Weight (kDa)

6.02

Isoelectric Point (pI)

98.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 142, 164
AcsI RAATTY 2 cut(s) 85, 99
AgsI TTSAA 1 cut(s) 113
AlwI GGATC 2 cut(s) 142, 164
AoxI GGCC 1 cut(s) 186
ApoI RAATTY 2 cut(s) 85, 99
AsuHPI GGTGA 1 cut(s) 69
BccI CCATC 3 cut(s) 31, 82, 164
BmsI GCATC 1 cut(s) 19
BpmI CTGGAG 1 cut(s) 90
BsaBI GATNNNNATC 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 107
Bse8I GATNNNNATC 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 139
BseMII CTCAG 1 cut(s) 188
BseNI ACTGG 1 cut(s) 107
BshFI GGCC 1 cut(s) 188
BsmI GAATGC 1 cut(s) 204
BsnI GGCC 1 cut(s) 188
Bsp143I GATC 2 cut(s) 134, 169
BspANI GGCC 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 187
BspPI GGATC 2 cut(s) 142, 164
BsrI ACTGG 1 cut(s) 107
BssMI GATC 2 cut(s) 134, 169
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 2 cut(s) 137, 172
BstMBI GATC 2 cut(s) 134, 169
BstMWI GCNNNNNNNGC 1 cut(s) 194
BsuRI GGCC 1 cut(s) 188
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 136, 171
DpnII GATC 2 cut(s) 134, 169
FaiI YATR 1 cut(s) 15
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 188
HinfI GANTC 3 cut(s) 19, 44, 178
HphI GGTGA 1 cut(s) 69
Hpy188I TCNGA 2 cut(s) 177, 210
Hpy188III TCNNGA 1 cut(s) 182
HpyAV CCTTC 2 cut(s) 156, 160
HpyCH4V TGCA 2 cut(s) 10, 204
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 174
Kzo9I GATC 2 cut(s) 134, 169
LpnPI CCDG 1 cut(s) 120
LweI GCATC 1 cut(s) 19
MalI GATC 2 cut(s) 136, 171
MboI GATC 2 cut(s) 134, 169
MluCI AATT 2 cut(s) 85, 99
MnlI CCTC 4 cut(s) 90, 114, 178, 183
Mva1269I GAATGC 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 2 cut(s) 134, 169
PctI GAATGC 1 cut(s) 204
PfeI GAWTC 3 cut(s) 19, 44, 178
Sau3AI GATC 2 cut(s) 134, 169
SetI ASST 2 cut(s) 82, 130
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 5 cut(s) 50, 107, 119, 194, 210
Sse9I AATT 2 cut(s) 85, 99
TasI AATT 2 cut(s) 85, 99
TfiI GAWTC 3 cut(s) 19, 44, 178
TspDTI ATGAA 1 cut(s) 48
XapI RAATTY 2 cut(s) 85, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.